1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
3 years ago
13

What is the best explanation scientists have been able to come up with for the appearance of Ostrich-like birds in different con

tinents?
A. People most likely took the birds to different continents

B. Ostoches could have arisen through spontaneous generation

C. The distribution of some groups of Ostrich-like birds may have been influenced by continental drift in what is known as Pangea

D. Darwin likely took an Ostrich he found in one continent to another and that is how they spread

Biology
1 answer:
mina [271]3 years ago
3 0

B is the answer

Explanation:

You might be interested in
Anticodons are found in what molecule?
Ray Of Light [21]

Answer:

tRNA.

Explanation:

RNA molecule is made from the template DNA by the process of transcription. Three main different types of RNA molecule are rRNA, mRNA and tRNA.

tRNA  or transfer RNA is an one of the most important RNA molecule. tRNA molecule contains the anticodon that are complementary to the codon of the RNA molecule. tRNA specifies for a particular amino acid.

Thus, the correct answer is option (C).

8 0
3 years ago
You are an evolutionary entomologist. You have observed beetles that can raise their abdomens and give off a defensive chemical
bagirrra123 [75]

Answer:

mimicry

Explanation:

Mimicry -

It is the resemblance in between two organisms of different species or may be of the same species .

The main reason for mimicry is the protection of the species from the predators .

From the question , the beetles in the second case mimic the characteristic of the first beetle , by raising their abdomen , just top protect them selves .

Hence , the correct term for the given question is - mimicry .

4 0
3 years ago
All of the following are examples of environmental influences on the development of personality disorders except __________. A.
Elden [556K]

The answer is C. This is because the other choices involve experiences (most during childhood a significant phase in humans development) that are environmental factors that impact on the human personality. In choice C, there is little development since its adulthood phase and on the other hand, refusing to display warmth and emotion is not an experience.






5 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How long does it take for a ziploc to biodegrade
ASHA 777 [7]

plastic items take up to 1000 years to decompose in landfills. But plastic bags we use in our everyday life take 10-20 years to decompose, while plastic bottles take 450 years.

I hope this helps

8 0
3 years ago
Other questions:
  • Which statement BEST explains how RNA polymerase knows where to start and stop making an RNA copy of DNA?
    10·1 answer
  • What is the probability of producing a tall pea plant from a generic cross between two hybrid tall pea plant
    12·1 answer
  • What type of stress occurs when a rock mass is pushed in opposite directions?
    9·1 answer
  • With the global population constantly increasing, at some point food will become limited. What is a way that should NOT be used
    7·1 answer
  • Jessica is traveling from Chicago, Illinois, to Miami, Florida. Using the map, tell what will happen to the land as she travels
    15·2 answers
  • PLZ HELP! WILL GIVE BRAINLIEST!!<br> (listen to Tiagz! His new song 'Isabelle' just came out today)
    10·2 answers
  • Which theory best explains the present arrangement of continents oceans and landforms on earth
    12·2 answers
  • Which observation could be used to determine that an organism is an autotroph?
    10·2 answers
  • 4. Analyze the roles of greenhouse effect<br>agriculture sector in Bhutan.<br>in the<br>-​
    7·1 answer
  • Which nucleic acid provides the master code for protein synthesis? DNA RNA mRNA tRNA
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!