1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
4 years ago
6

Which phase of meiosis is represented here?

Biology
1 answer:
kumpel [21]4 years ago
6 0
The correct answer is C.
You might be interested in
Predict what the calf produced in a union between each of these parents might look like. Explain your answers.
Charra [1.4K]
We know that purebred means that the organism contains the same alleles for the trait and hybrid means that it contains two different alleles for the trait. Dominant means that it will be shown in a hybrid and a purebred, but recessive traits will only be shown in purebred recessive organisms.

a) The offspring of a purebred white (recessive) cow and a purebred brown (dominant) bull, would be all hybrid brown (dominant). This is because as I stated above, dominant traits are shown when the offspring has both dominant and recessive alleles for the same trait.

b) The offspring of a purebred brown (dominant) cow and a purebred brown (dominant) bull would all be purebred brown (dominant). This is because if both of the parents have only alleles that code for brown color, the only color that the offspring can be is brown.

c) The offspring of a purebred white (recessive) cow and a purebred white (recessive ) bull would all be purebred white (recessive), for the same reason stated above in part b), the only difference being that the alleles are recessive and code for white color instead of being dominant and coding for brown color.

d) The offspring of a hybrid brown (dominant) cow and a purebred white (recessive) bull would be half hybrid brown (dominant) and half purebred white (recessive). This can be seen best if you set up a Punnett Square, which is a diagram that shows allele frequencies in offspring. This shows you that the chance that the offspring get the dominant allele from the mother cow is 50%, thus 50% would be hybrid brown (dominant), as the father can contribute only a recessive white allele. The other 50% would be purebred white (recessive) because the mother cow would be contributing a white allele and so would the father.

Hope this helps! :)
7 0
3 years ago
Then, answer the questions that follow.
Leona [35]

Answer:

Asexual,2,Conjugation

Explanation:

7 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Sharks have highly developed _____?
lesya692 [45]
The answer is C. olfactory receptors
7 0
3 years ago
Read 2 more answers
Gel electrophoresis is used to __________ dna fragments
Serga [27]
The answer is A. seperate
3 0
3 years ago
Read 2 more answers
Other questions:
  • !!!!WILL MARK BRAINLIEST!!!!
    13·2 answers
  • Introducing additional organisms of the same existing kinds will not upset the ecosystem.
    10·2 answers
  • What the basic building blocks of matter called?
    11·2 answers
  • The nurse caring for a client with tuberculosis anticipates administering which vitamin with isoniazid (inh) to prevent inh-asso
    15·1 answer
  • The __________ is the lowest level of life's structural hierarchy.
    5·2 answers
  • Hookworms live inside the intestines of dogs. As the dog eats, the hookworms consume partially digested food. As a result of thi
    14·1 answer
  • Which body part is used to measure a horses body
    7·2 answers
  • 3. Why do living organisms need nutrients?
    14·2 answers
  • What is compacted dna wrapped around proteins called?
    5·1 answer
  • In the final stage of glucose metabolism, the high-energy electrons from NADH and FADH2 are removed and used to produce more ATP
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!