1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
14

To use less of a resource

Biology
1 answer:
gizmo_the_mogwai [7]3 years ago
4 0
What???
Explanation: ???
You might be interested in
I need 5 paragraphs about global warming pleaseeee!!!
Roman55 [17]
Global warming is the current increase in temperature of the Earth's surface (both land and water) as well as it's atmosphere. 
7 0
3 years ago
Please answer all. Worth 50 points. Will mark you Brainliest if you answer all (as well as you can), for an extra 25 points!
Kay [80]

Answer:

  1.     d) the number of protons in an atom of the element
  2.     a) They emit radiation as they decay
  3.     a) loses electrons
  4.     c) polar
  5.     b) it lowers the pH
  6.     a) It results in a new substance that is not the same substance
  7.     c) atomic number
  8.     d) acid: proton; base: electron pair
  9.     b) an atom with a single electron in its outermost shell

Hope this helps!!

3 0
3 years ago
You have two substances. Alcohol: density 0.8 g/ml and Glycerin: density
pshichka [43]

Answer:

The alcohol will float

Explanation:

Alcohol is less dense than water, compared to Glycerin which is more dense than water, (Water's density is 1.0)

7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What is mitochondria
vesna_86 [32]
<span>an organelle found in large numbers in most cells, in which the biochemical processes of respiration and energy production occur. It has a double membrane, the inner layer being folded inward to form layers (cristae). </span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • It is 10 a.m. and Julie is trying to decide what to prepare for tonight's dinner. She selects a frozen turkey breast and must th
    13·1 answer
  • What is the photosynthesis equation? Will name BRAINLIEST!!
    15·1 answer
  • What features are formed when oceanic plates converge? Mark all that are correct. Question options: A) Oceans B) Earthquakes C)
    10·1 answer
  • The best scientific theories not only explain and organize known facts but also __ __.
    8·2 answers
  • At various times, Cynthia, a 20 year-old college student, has been considered by her family and/or friends to be moody, high-str
    6·1 answer
  • Bacteria convert atmospheric nitrogen to which of the following in the process of nitrogen fixation?
    9·2 answers
  • Rita was all ears when Lee told her the secret. Lee knew that Rita would not spill the beans. Rita has always been a true friend
    10·2 answers
  • You have learned about fermentation and how it can be used to produce food products like yogurt and bread. What other products—f
    13·1 answer
  • How might a mutation in the DNA of the Piedmontese bull lead to muscle hypertrophy
    10·1 answer
  • What Helps to maintain the plasma membranes fluidity?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!