1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
3 years ago
5

Which changes the litmus paper to red

Biology
1 answer:
morpeh [17]3 years ago
7 0

Answer:

Acidic substances

Explanation:

For example : lemon,acid sulfuric,acid nitrate

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Male peacocks have tail feathers that make up about 60% of their body length. during the mating season they contract muscles to
vovikov84 [41]
<span>The first part of the question is: The male's ability to shake its tail is the mechanistic cause of this behaviour. For the second part of the question, the mate choice is the adaptive function of this behaviour.</span>
7 0
3 years ago
Explain blood curculation in human body in brief (in 100 words)​
bekas [8.4K]
Circulatory system pumps blood from the heart to the lungs to get oxygen. The heart then sends oxygenated blood through arteries to the rest of the body. The veins carry oxygen-poor blood back to the heart to start the circulation process over. Your circulatory system is critical to healthy organs, muscles and tissues.
4 0
2 years ago
What is the purpose of the Line of defense
rusak2 [61]

Answer:

The three lines of defense model enhances the understanding of risk management and control by clarifying roles and duties. The model provides guidance for the implemented structure and the assigned roles and responsibilities of parties to increase the effective management of risk and control

Explanation:

the first line of defence – functions that own and manage risk. the second line of defence – functions that oversee or specialise in risk management, compliance. the third line of defence – functions that provide independent assurance, above all internal audit.

7 0
3 years ago
Read 2 more answers
~ soda is ...
soldi70 [24.7K]
Answer: D

Explain:
For example, an unopened soda in a bottle has a uniform composition and is a homogeneous mixture. Once you open the bottle, bubbles appear in the liquid. The bubbles from carbonation are gasses, while the majority of the soda is liquid. An opened can of soda is an example of a heterogeneous mixture.
8 0
3 years ago
Read 2 more answers
Other questions:
  • After 12 PCR cycles how many DNA strands would be available?
    15·1 answer
  • When electron pairs are shared among two or more chemical bonds, the molecule is said to have which of the following properties?
    5·1 answer
  • When a flying bug hits a moving train, no effect is observed on the train because
    9·2 answers
  • Meaning of purulent exudate
    9·1 answer
  • Asexual reproduction is based on a type of cell division known as (mitosis, meiosis) and occurs most often in (more complex, les
    8·1 answer
  • Which of the following is a characteristic of RNA splicing in Eukaryotes?
    7·1 answer
  • Why can a deficiency in all types of blood cells cause bruising?
    15·1 answer
  • What description best explains why viruses can become more pathogenic to host that were not affected by the virus before?
    7·1 answer
  • Sedimentary rock is made from sediments that come from other rocks. These sediments form from _____ of the rocks.
    12·2 answers
  • Once the cell has gone through interphase, it is ready for division. What is this process called?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!