1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adelina 88 [10]
3 years ago
9

How can reproductive isolation lead to speciation?

Biology
1 answer:
hram777 [196]3 years ago
8 0
How can reproductive isolation lead to speciation<span>? If populations cannot mate successfully with one another, genetic differences may accumulate in the populations. Over time they become very different and give rise to new species.</span>
You might be interested in
Which of the following structures serves as the cell’s boundary from its environment?
Vikentia [17]

Answer:

Either the cell wall or the cell membrane

Explanation:

8 0
3 years ago
The closest living relatives to orangutans are:
GalinKa [24]
Answer: great apes explanation:
6 0
3 years ago
Which material has the highest thermal conductivity? Which material has the highest electrical conductivity? Explain why thermal
olga55 [171]

Answer:Silver

Explanation:Silver has the highest electrical conductivity of all metals. In fact, silver defines conductivity - all other metals are compared against it. On a scale of 0 to 100, silver ranks 100, with copper at 97 and gold at 76.

4 0
3 years ago
Read 2 more answers
Which amino acid chain will be formed by the codons shown below GGU AGC CGG
Oksi-84 [34.3K]

The answer is Gly-Ser-Arg

4 0
3 years ago
What type of succession takes place after lava from a volcanic eruption covers an area
Romashka-Z-Leto [24]

Secondary since plants/animals already lived there, but got killed/driven out of the area they lived/thrived in/on.

7 0
3 years ago
Other questions:
  • If an individual has an extra chromosome in every one of its cells, what mutation must have occurred? (1 point)
    15·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is used to show alleles (different forms of genes) in a genetic diagram
    6·1 answer
  • Why is the sickness caused by trypanasomes called African sleeping sickness?
    13·1 answer
  • How does the genetic code of a eukaryote organism compare to that of a prokaryote organism?
    8·1 answer
  • What are cytokines; what role do they play in cancer treatment? Give an example of one in your answer.
    13·1 answer
  • The desert and tundra are alike because they both have A) extreme daily temperature changes. B) large seasonal variation. C) lim
    7·2 answers
  • Introduced species often thrive and multiply in an environment very different from their original one. Why are they often able t
    15·1 answer
  • Briefly explain how sexual reproduction generates new allele combinations in offspring.
    11·1 answer
  • Respira
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!