1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
11

Why are fossil fuels considered nonrenewable resources? A. They form quickly due to decaying biomass. B. They require both sunli

ght and water to form. C. They cannot be used to create electricity. D. They take millions of years to form.
Biology
1 answer:
Zarrin [17]3 years ago
8 0

Answer:

B

Explanation:

Just go with it.

It's Right.

You might be interested in
Select the term that best describes the type of transport occurring in the below
sweet-ann [11.9K]

Answer:

<em> osmosis</em><em> will be the answer</em>

4 0
4 years ago
Read 2 more answers
Although a manatee is sometimes called a "sea cow," in what way is it more like a horse than a cow?
sergiy2304 [10]

Answer: They are both large and eat plants. They also have long intestines

Hope this helped :)

Explanation:

3 0
3 years ago
Some leukocytes absorb entire ___ by the process of phagocytosis.
SCORPION-xisa [38]

Answer:

Bacteria

Explanation:

Leucosomes are the white blood corpuscles or WBCs which is come out to protect the body from bacteria and other infections.

6 0
4 years ago
Ocean current direction is influenced by
Brrunno [24]

Answer: C. Prevailing winds

Explanation:

Several factors influence the direction of the sea current, and the prevailing wind is one of them. Surface winds are certainly one of the most critical factors affecting the direction of movement. In addition to this factor, the evolution of the sea current is also influenced by the earth's rotation, temperature, the attractive force of the moon and river flows.

5 0
3 years ago
How long does it take for a package to come from uk to arizona?
Sunny_sXe [5.5K]
It depends most packages take 2-3 weeks so I’m guessing about 4 or 5?
4 0
4 years ago
Other questions:
  • What logical scientific inference can be drawn from the observation that many different species have homologous structures?
    12·1 answer
  • Explain how xylem and phloem contribute to the strength of wood.
    7·1 answer
  • Discuss why cell division is essential in the developmental stages of fetal growth as it relates to cell communication that lead
    14·1 answer
  • Lancelets and tunicates are two groups of chordates. classify each statement as applying to lancelets, tunicates, both lancelets
    14·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • ____ is a type of weathering where rock is dissolved by an acid.
    13·1 answer
  • Which of the following is consumed by the photosynthesis reaction occurring in plants?
    6·1 answer
  • What is the material all about ?​
    6·1 answer
  • A plant cell has a 5%, percent salt concentration. It is placed into a solution
    11·1 answer
  • The only thing plants do in the ecosystem is provide food?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!