1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
2 years ago
14

How does acid help digestion

Biology
1 answer:
Nutka1998 [239]2 years ago
4 0

Answer:

When digesting food, acids in your stomach help break down the food particles to easily travel into your intestines!

You might be interested in
Which one of these is an example of cell division at work
VMariaS [17]

Answer is A.

Cell have to spilt themselfs apart to make more cells for the system. Tree are like cells because they sometimes have seeds in them that help generations of trees grow!

5 0
3 years ago
"In the experimental setup below, which substance would be used to prove that the gas produced by the yeast in the vacuum bottle
mrs_skeptik [129]
I'm not totally sure. But in my view, <span>(4)a salt solution</span> would be used to prove that the gas produced by the yeast in the vacuum bottle could change the pH of the liquid in the flask
3 0
3 years ago
Read 2 more answers
Diffusion of oxygen from an alveolus into a pulmonary capillary belongs to which aspect of respiration?
Eva8 [605]
Cellular respiration
3 0
3 years ago
There is more biodiversity
BartSMP [9]

Answer:

Would you like help with anything about biodiversity? I'd be glad to help! :D

3 0
2 years ago
Read 2 more answers
What is the cleanest burning fossil fuel?
Alexandra [31]
Natural gas (methane (CH4)) is the cleanest burning fuel<span>, emitting the smallest amount of carbon dioxide of all the </span>fossil fuels<span> (coal, oil and natural gas).</span>
7 0
3 years ago
Other questions:
  • How many germ layers do flatworms have?
    14·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Assuming the stomata are open to the same degree, the rate of transpiration should _____ on a rainy day compared with a sunny da
    9·1 answer
  • Why are coastal areas cooler during the day than inland areas?
    9·2 answers
  • A vegetable garden is 12 meters long by 7 meters wide. It is home for 168 mice. What is the population density of the mice?? Hel
    11·2 answers
  • Please Help! Which material undergoes radioactive decay? A) all elements that have a half-life B) all elements that contain atom
    6·1 answer
  • If you don't like a certain food you could hide much of the taste by closing your eyes, holding your nose, pinching your skin, a
    14·1 answer
  • What is the difference in terms of function and structure for arteries and veins?
    13·1 answer
  • Giving 50 pts answer correctly for the points Vertebrates share many physical characteristics. All vertebrates
    10·1 answer
  • Assertion (A): A proton gradient cannot be established in the mitochondria.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!