1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guapka [62]
3 years ago
9

Why do you like biology?

Biology
2 answers:
lions [1.4K]3 years ago
8 0
Because it shows a different theory between things we mistaken in our everyday life's. Biology is a sign of life and Adventure for all life. Without science we wouldn't have much...
kifflom [539]3 years ago
8 0
It's really good and fun!
You might be interested in
Which statement most likely describes the daughter cells produced?
Naddik [55]

You're gonna have to give us a picture to support your question..

8 0
3 years ago
Where is the asthenosphere located? (Select all that apply.) Right below the crust In the lower mantle. In the upper mantle. Rig
tester [92]
Right below the crust.
6 0
3 years ago
Read 2 more answers
The diagram below shows a certain method of grazing animals
WITCHER [35]

Answer:

In agriculture, rotational grazing, as opposed to continuous grazing, describes many systems of pasturing, whereby livestock are moved to portions of the pasture, called paddocks, while the other portions rest.

Explanation:

hehe ....

5 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which cell structure are seen in all cell types
Lisa [10]
Cytoplasm<span>, the rest of the material of the cell within the </span>plasma membrane<span>, excluding the nucleoid region or </span>nucleus<span>, that consists of a fluid portion called the cytosol and the organelles and other particulates suspended in it. Ribosomes, the organelles on which protein synthesis takes place.

Hope this helps !!!^_~!!!</span>
3 0
3 years ago
Other questions:
  • How many minutes do cells spend in each phase of mitosis?
    8·2 answers
  • What effect will high salt intake have on urine volume?
    15·1 answer
  • Why should people care about invasive species?
    15·1 answer
  • Which term is defined as a place in the mantle where magma rises, often melting the crust above
    10·1 answer
  • Define each of the following and contrast them with one another 1 mineral 2 metal 3 ore 4 alloy
    15·1 answer
  • Which of the following could have been components of membranes that covered pre-cells in ancient earth
    14·1 answer
  • The buoyant force acts in all directions.
    6·2 answers
  • What precipitation that seeps into the ground and is stored in tiny holes in soil and rocks
    15·1 answer
  • C6H12O6 + 6O2 --&gt; 6H2O + 6H2O
    14·1 answer
  • Select the correct location on the image. Keiko’s teacher was discussing the theory of endosymbiosis. She asked Keiko to mark th
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!