1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
7

55:09

Biology
1 answer:
marta [7]3 years ago
8 0

Answer:

The best option that describes meiosis is the last one: "It produces male and female sex cells"

Explanation:

Meiosis is the process of making offspring, from the joining of a sperm cell, from a male, and an egg cell, from a female, to the creation of a zygote. In order for life to be created (at least for a human baby), it'll need 46 chromosomes. And so 23 chromosome come from the sperm cell while the other 23 come from the egg cell.

You might be interested in
What would be the best microscope to view living single-celled organisms in a sample of pond water?
nikdorinn [45]
A compound light microscope
6 0
3 years ago
The first organisms on Earth were able to transform the carbon dioxide in the air into what essential element needed for modern
Len [333]
D. Oxygen  
We wouldn't be here without it
4 0
3 years ago
Read 2 more answers
Which of the following statements is an inference?
cupoosta [38]

Answer:

D

Explanation:

Because it does not point out the exact power that is out

4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What is the phenomenon that takes place at the level of the green leaves of the carrot
gulaghasi [49]

Explanation:

tttyyygftj that's all I have

3 0
3 years ago
Other questions:
  • The molecule of water is decribed as a polar molecule
    12·1 answer
  • How can I remember the definition of RFLPs? Read below for the definition. I need help memorizing it.
    13·1 answer
  • Diversifying selection typically results in a population with only one allele. purifying selection best describes the removal of
    10·1 answer
  • what occurs when an inducer is added to a medium containing an organism with a metabolic pathway controlled by a repressor?
    14·1 answer
  • The nurse is preparing to discharge a 30-year-old woman who has experienced a miscarriage at 10 weeks of gestation. Which statem
    13·1 answer
  • Based on the DNA strand here, what is the contemporary: 5’- ACTGACATG -‘3
    12·2 answers
  • Which of the following statements about metabolism in
    7·1 answer
  • Question 9 of 30
    9·1 answer
  • A description of the three topics, concepts, or theories you learned about in the module that you consider most important; choos
    15·1 answer
  • Why it is important for a cell to be able to differentiate?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!