1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
12

3. Juan caught a fish that weighed 7.5

Biology
2 answers:
sveta [45]3 years ago
6 0

Answer:

24.75

Explanation:

The first thing you need to do is subtract 32.25 which is the total minus 7.5 which is Juan's total then you will get the answer of 24.75.       If you want to find out how much each one of Orlando's fish weighed all you have to do is divide 24.75 by 3 and you get 8.25.

Andrew [12]3 years ago
5 0

Answer:

26

Explanation:

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Primary succession ______.
Jet001 [13]
C) Occurs in areas without soil.
Primary succession occurs in lifeless areas in which <span>soil that is incapable of sustaining life is formed due to lava, sand dunes, and </span><span>rocks left from a retreating glacier.</span>
4 0
3 years ago
Hey omg its been 2 weeks since we talked.! Aww i missed you soooooooooooooooo much! Oh -giggles- you're really funny y/n. Oh sur
horrorfan [7]
UwU *can’t stop thinking about out encounter*
7 0
2 years ago
Read 2 more answers
What happens during meiosis I and meiosis II?
makvit [3.9K]

Answer: In meiosis I, homologous chromosomes partitioned, whereas in meiosis II, sister chromatids isolated. Meiosis II produces 4 haploid girl cells, though Meiosis I produces 2 diploid girl cells. Hereditary recombination (crossing over) as it were happens in meiosis I.

Explanation:

7 0
2 years ago
Read 2 more answers
Which behavior is considered a courteous way to deal with a client
erica [24]

Answer: Several behaviors can be considered as cuts when dealing with a client.

Explanation:

Human beings are social beings, we like to interact with each other, but often these interactions do not always occur in the right way. There are several jobs where people have to have an approach with the client and treat them in the best way, which is part of providing a good service.

Various behaviors are considered as cuts when dealing with a client, one of them is being efficient and friendly. When a client enters the person must show a friendly attitude, which allows the client to express what they need. Efficiency must also be shown at the time of performing the work since a person who is occupying a job is because he is capable of performing the work.

Another behavior that can be considered as cuts when dealing with a client is to listen actively. Many people make the mistake of not actively listening to their customers, which can often cause problems when providing a product or service, or simply listen to the customer's complaints. It is important to make the client feel that he is heard, that what he has to say is important.

Keeping calm in any situation is also a way of being courteous to the client. Each person is different, so not all of them will have the same mood at that time. It is important to remain calm and be professional when dealing with a client. It is not correct to respond inappropriately if the client does so, professionalism must be above all. If a client behaves in a certain way, reporting it might be a good idea, but not reaching the point of using the same tone or way of acting that the client used at the time.

7 0
3 years ago
Other questions:
  • When a scientist contrasts two or more objects what is he or she looking for
    6·1 answer
  • Study the diagram. An ocean with points labeled 1 through 6. Water level scale is on the left, from 0 kilometers to 15 kilometer
    8·2 answers
  • Which is a difference between bacteria and viruses that shows that bacteria are living organisms and viruses are not?
    15·2 answers
  • How do we classify finger prints?
    13·1 answer
  • Alf lifts weights vigorously for 25 minutes. A few hours after exercise, he notices that his muscles are sore and slightly swoll
    6·1 answer
  • When individuals of the same species are reproductively isolated, genetic differences may accumulate in sufficient number so tha
    5·1 answer
  • Based on your investigation, what challenges do scientists face when classifying a new fossil?
    5·1 answer
  • 14. List in order the organic compounds from simple to most complex: Lipids, nucleic acids, carbs &amp; protein.
    12·1 answer
  • A local town has a problem with too many mice running around. In response to this they start a war on the mice, and get neighbor
    9·1 answer
  • Can some please answer this 4 questions!!!!!!!!!!!!!!! <br><br> Giving brainliest!!!!!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!