Answer:
B. Each layer of a soil profile
Explanation:
I took the test and got it right
In the nucleus of the cell, there are chromosomes that contain genetic material
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
<span> </span> <span>Mining is considered the dangerous job in the United States.
Hope this helps!</span>
(c) One corollary of the second law of thermodynamics states that the change in entropy<span> of </span>a closed system<span> must be greater than zero or equal to zero. (d) </span>A closed system can experience an increase in entropy only when<span> irreversibilities are present within the </span>system<span> during the process.</span>
