AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
When literacy rates goes up then crude birth rates will automatically be decline
Explanation:
Crude birth rate refers to the number of births /1000 in a population. It doesn’t count the age and sex in a population.
General fertility corresponds to number birth of a women age between 15- 49 in a year.
Factors Affecting fertility Rates: Healthcare,Education
Healthcare: Improvement in healthcare leads to drop infant mortality rate , knowledge of birth control measures and economic status have an impact on birth rates.
Education: Female literacy rate and knowledge of birth control and employment opportunities also decline crude birth rate.
Initiation:
In the cytoplasm, protein synthesis is actually initiated by the AUG codon on mRNA. The AUG codon signals both the interaction of the ribosome with m-RNA and also the tRNA with the anticodons (UAC). The tRNA which initiates the protein synthesis has N-formyl-methionine attached. The formyl group is really formic acid converted to an amide using the -NH2 group on methionine (left most graphic)
The next step is for a second tRNA to approach the mRNA (codon - CCG). This is the code for proline. The anticodon of the proline tRNA which reads this is GGC. The final process is to start growing peptide chain by having amine of proline to bond to the carboxyl acid group of methinone (met) in order to elongate the peptide.
