1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
14

-3b - 15 > -24−3b−15>−24

Biology
1 answer:
Ivan3 years ago
3 0

Answer:

hello :D

Explanation:

You might be interested in
For average organism, heavy digestion (overnight with an excess of enzyme) of chromatin with micrococcal nuclease would yield a
ASHA 777 [7]

Answer:

150 - 300 bp

Explanation:

Micrococcal nuclease, indistinctly from the time of treatment and in average organisms, will realize the cuts on DNA o RNA zones rich in AT or AU. It is not a specific endonuclease.

Even so, the mean size of the expected fragments will have between 150 bp and 300 bp.

It is very important to run your digestion along with a proper label.

5 0
3 years ago
What qualities do humans have that think could never be replaced by robots
vitfil [10]

Humans have emotions and free will; robots do not.

3 0
3 years ago
Compare hypertonic, hypotonic, and isotonic solutions. When an environment is hypotonic, what happens to the cell?
algol13

When an environment is hypotonic, the cell has more solute so solvent move from outside the cell to inside causing the cell to swell.

WHAT IS TONICITY?

  • Tonicity is the ability of a solution to induce water loss or water gain in a cell. A solution can either be; hypertonic, hypotonic or isotonic

  • A hypertonic solution has more concentration of solute than its surroundings while a hypotonic solution has less concentration of solute compared to it's surroundings.

  • If a hypotonic solution has less solute, this means that it will have more solvent (water). Based on the principle of osmosis, water moves from a region of high concentration to region of low concentration.

Hence, water will move into a cell that is located in a hypotonic environment, causing it to swell.

Learn more: brainly.com/question/13802181?referrer=searchResults

3 0
3 years ago
Priya has been having trouble conceiving. She went through testing at a fertility clinic and found that everything seemed fine w
NARA [144]

Answer:

A. Estradiol

Explanation:

Estradiol, which is also referred to as 17 beta-estradiol, is an estrogen steroid hormone. This form of estrogen is one of the major female sex hormone that plays major role in the female reproductive system such as regulation of the estrous and menstrual cycle. It also helps in regulating body metabolism.

Reduction in the level of Estradiol is one of the problems common in women approaching menopause. Optimal level of estradiol in the body helps improve fertility in the body as symptoms such as such as vaginal dryness, burning, itching that are associated with menopause are reduced to the barest minimum.

The supplement taken by Priya in order to thin the mucus and allow sperm to get through the mucus to the uterus most likely works to benefit the body by increasing <em>estradiol.</em>

8 0
3 years ago
Read 2 more answers
What are TWO specific ways in which proteins are regulated in eukaryotic cells?
Tom [10]

Answer:

Feedback inhibition and allosteric regulation.

Explanation:

6 0
3 years ago
Other questions:
  • The specialist who provides cleansing treatments for the skin is a(n):
    9·1 answer
  • Compare the process of carbon fixation in C3 plants to that of C4 plants.
    14·2 answers
  • What carbohydrate is primarily used by the body to help the digestive system?
    10·2 answers
  • How is information on age structure and sex ratios useful to demographers?
    10·1 answer
  • Mycoplasma pneumoniae is a bacterium that lacks a cell wall. it causes atypical pneumonia. which antibiotic would be most effect
    7·1 answer
  • Water is held to a greater extent by clay than by sand.<br> true or false
    10·1 answer
  • Lactic acid build up in muscles is a sign that ________.
    5·1 answer
  • Please help me with this!
    14·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is the solid obtained at the neck of a funnel in sublimation?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!