1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
3 years ago
12

4. What is the layer of gas called which is foundStistosphere ?​

Biology
1 answer:
notsponge [240]3 years ago
7 0

Answer:

ozone layer

Explanation:

The infamous ozone layer is found within the stratosphere. Ozone molecules in this layer absorb high-energy ultraviolet (UV) light from the Sun, converting the UV energy into heat.

Hope this helps!

You might be interested in
How does the epithelial tissue found in the epidermis of the skin differ in structure from the connective tissue found in the de
Valentin [98]
The epithelial cells are always arranged in an orderly fashion on the basement membrane, but the connective tissue doesn't have a basement membrane. <span>They both help prevent foreign toxins from entering the body but the connective tissue also provides additional functions of insulation and supporting bones and muscles.</span>
7 0
3 years ago
What is the domain of archaea
ss7ja [257]
Archaea actually are a domain! Originally they were thought to be bacteria, but have since been classified in their own domain: archaea. 
7 0
4 years ago
Which of the following is not an example of an abiotic factor?
Jobisdone [24]
Abiotic means "not life," basically. So, abiotic factors are non living factors. Soil, air, and temperature, are all non living things. However, plants are biotic factors, meaning that they are living. So, the answer is plants, they are not an abiotic factor!
5 0
3 years ago
Read 2 more answers
What muscle is responsible for inflation and deflation of the lungs
IRISSAK [1]
<span>representative respiratory reflexes? Not so sure so confirm online

</span>
4 0
3 years ago
Read 2 more answers
Basic needs. Living things have basic needs in order to survive. Plants and animals have like needs. How they use the things req
kaheart [24]

Answer:

is bvasic living thing ok so obiously the answaer is c because it always is ((((((((((((((((answer c)))))))))))))))))))))))

ok so the looooongest word that most people kno is . but thats actually not that long to some people that kno long words so here is the longezt word in the wold, supenemendeddentenilisitationsentinalizinilitioninitialalizedcaliflagiliciousinitialdistintialidocioloassociationlationsensationinitiliationilitisintialidocious. so theres your answer ok an extremly long word for your game (use ok) accountiticationmicjationmasonyaynitiationpronoutiationnaysonnitiationassociationassistiation is still normal length you could say its used commonly around the world and in sentences/essays/paragraphs

Explanation:

8 0
3 years ago
Other questions:
  • What is ultrafiltration
    14·2 answers
  • Blood enters the pulmonary vein with close blank of the blinding site for oxygen saturated
    7·1 answer
  • The following is part of a newspaper article about a new variety of corn:
    11·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Was there a difference between the pulse rate of male and females? In your educated opinion, if there is a difference, what migh
    8·1 answer
  • PLS HELP ASAP!!!!!!!!!!!!!!!!!!!!!!!! PLEASE
    13·1 answer
  • 1. In this environment, which trait is adaptive for the birds?
    5·1 answer
  • Which of the following is accomplished by absolute dating? A. It allows us to measure an object's age in years. B. It allows us
    12·1 answer
  • Why do organisms need both mitosis and meiosis to process?
    6·1 answer
  • Membrane proteins that bind to signal by which cells communicate are called
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!