1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
3 years ago
6

The two narrow tubes that urine flows through from the kidneys to the bladder are the

Biology
1 answer:
ELEN [110]3 years ago
4 0

Answer:

<u>Two ureters.</u>

These narrow tubes carry urine from the kidneys to the bladder. Muscles in the ureter walls continually tighten and relax forcing urine downward, away from the kidneys. If urine backs up, or is allowed to stand still, a kidney infection can develop.

You might be interested in
Name the process in which a cell develops new sub-cellular structures to let it perform a specific function:
gtnhenbr [62]

Answer:

Explanation:

In the process of differentiation the stem cells develop different sub-cellular structures to turn into the different types of cells - specialisation. The specialised cells can now carry out their important specific functions - essential for the efficient and healthy viability of any organism.

8 0
3 years ago
PLEASE HELP! WILL MARK BRANLIEST
aliina [53]

Answer:

A

Explanation:

Tt (heterozygous) RW (shows codominance) Bb ( full bush is dominant)

8 0
3 years ago
Read 2 more answers
I need help!! I need to write what I learn about the video.. here is the link of the video https://youtu.be/Hdl_PyMFNro please a
attashe74 [19]

Spring tides have the largest difference between low and high tides. They only occur during Full and new moons or when the Sun , Moon,  and Earth are in a straight line. Neap tides have the smallest difference between high and low tides and only occur during a 1st or 3rd quarter moon or when the Sun, Moon, and Earth are at a 90 degree angle.

7 0
4 years ago
As bones grow longer and thicker they become not only strong but also heavier. How would heavier bones affect your movements
Verizon [17]
It would be Agility

Explanation: a number of factors can affect bone health like the amount of calcium in your diet
5 0
3 years ago
In relating the single “gate theory” to acupuncture, where is the so-called “gate” located? In the Cerebrum In the Thalamus At a
almond37 [142]

Answer:

At a level in the spinal cord  

Explanation:

The gate theory was elaborated in 1965 by P.D. Wall and r. Melzack, to explain the influence of tactile skin stimulation on pain relief. It essentially admits that there exists in the medullar posterior horns (located behind the central canal of the spinal cord) a gate-acting neural mechanism that can control the passage of nerve impulses transmitted from the peripheral fibers to the CNS through the medulla.

The gate regulates the influx of nociceptive impulses even before a perception of pain is created. The variation in the passage of action potentials (nociceptive) that the gate produces is determined by the activity of the thick (A-alpha and A-beta) and thin (A-delta and C) fibers, as well as cognitive influences.

3 0
3 years ago
Other questions:
  • During which phase of the cell cycle is a cell's DNA copied?
    9·2 answers
  • What is considered succession? Select all that apply
    13·1 answer
  • The process in which the ovaries release one mature egg each month is called
    14·1 answer
  • Some scientists believe that a change in climate is causing Earth's glaciers to rapidly melt. How will this affect polar bears?
    9·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Which part of society uses the<br> greatest amount of available<br> freshwater?
    10·1 answer
  • What part of the digestive system first causes chemical changes to food?
    5·2 answers
  • Please help on this question
    6·2 answers
  • What is the main advantage of sexual reproduction? high mutation pate need to find a mate ability to create exact genetic copies
    13·1 answer
  • When more water is needed in the bloodstream, the __________ releases antidiuretic hormone.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!