1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
14

I need it ineaqualitiss

Mathematics
1 answer:
garri49 [273]3 years ago
3 0

Answer:

I fucucuficucugugiciofof

Step-by-step explanation:

You might be interested in
10+2(x - 7) - 4+3(x+6) - 1 (distributive property)
Alja [10]
I got 5x-9 as the answer
6 0
3 years ago
A truck driver is driving from Nome, Alaska to Death Valley, California. Because he is traveling between locations with extreme
Andrews [41]

The inequality to represent the temperatures at which the gas in the truck will remain in liquid form is -40 < x < 140

<h3>Part A: The inequality</h3>

Let the temperature of the gas be represented with x.

When the temperature hits −40° F (or below), the gas freezes.

This means that the gas temperature must always exceed −40° F to remain being a liquid

i.e x > −40

Also, when the temperature hits 140° F (or above), the gas evaporates.

This means that the gas temperature must always be less than 140° F to remain being a liquid

i.e x < 140

So, we have:

x > −40 and x < 140

Rewrite as:

-40 < x and x < 140

Combine both inequalities

-40 < x < 140

Hence, the inequality to represent the temperatures at which the gas in the truck will remain in liquid form is -40 < x < 140

<h3>Part B: The description of the graph</h3>

In (a), we have:

-40 < x < 140

The end points of the inequalities use a less than sign.

Less than signs are represented by open circle.

Hence, the graph would use an open circle, and intervals between -40 and 140 would be shaded

<h3>Part C: Would −49° F gas remained in liquid form?</h3>

We have:

-40 < x < 140

The number -49 is not in the range -40 < x < 140

Hence, the gas would not remain in liquid form (in fact, it would freeze because it is less than -40)

Read more about inequalities at:

brainly.com/question/24372553

#SPJ1

8 0
2 years ago
8x+5 <br> 3x+8<br> Find the measurement of x!!
Soloha48 [4]

Answer:

Step-by-step explanation: look at the picture

8 0
3 years ago
The length of a rectangle is seven times its width. The area of the rectangle is 175 square centimeters. Find the dimensions of
dimulka [17.4K]

Answer:

<h3>The length is 35cm</h3><h3>The width is 5cm</h3><h3 />

Step-by-step explanation:

Area of a rectangle = l × w

where

l is the length

w is the width

The length is seven times the width is written as

l = 7w

Area of the rectangle = 175 cm²

7w × w = 175

7w² = 175

Divide both sides by 7

w² = 25

Find the square root of both sides

w = √25

w = 5cm

But l = 7w

l = 7(5)

l = 35cm

The length is 35cm

The width is 5cm

Hope this helps you.

7 0
3 years ago
The dot plots below show the test scores of seventh- and eighth-grade students: Dot plot for Grade 7 shows 6 dots on score 50, 4
sergeinik [125]
The answer for this question is Grade 7 I believe.
3 0
3 years ago
Read 2 more answers
Other questions:
  • At Central High School, 28% of the students are Freshmen, 26% are Sophomores, 24% are Juniors, and 22% are Seniors. The student
    15·1 answer
  • How do you write 89,637,421 in word and expanded form
    10·2 answers
  • Graph the image of the figure after a dilation with a scale factor of 3 centered at (2, −7). Use the Polygon tool to graph the q
    14·1 answer
  • Claudia goes on a road trip; her car gets 24 miles per gallon (mpg) and gas costs $3.02 per gallon. Let n represent the number o
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • The radioactive element carbon-14 has a half-life of 5750 years. The percentage of carbon-14 present in the remains of plants an
    5·1 answer
  • 0.0000003105 in scientific notation
    8·2 answers
  • I will give brainliest for correct answer !
    5·2 answers
  • A certain species of fish require 1.5 cubic feet of water per fish to maintain a
    12·1 answer
  • A flowerbed has an area of 12 square meters. What is the largest possible perimeter of the flowerbed?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!