1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
3 years ago
12

Climate change can alter where species live, how they interact, and the timing of biological events, which could fundamentally t

ransform current ecosystems and food webs. Evaluate each of the changes that can occur within an ecosystem . Select ALL of the changes that could be caused by rising temperatures.
Biology
1 answer:
nadya68 [22]3 years ago
8 0

Answer:Answer is A) B) C) D)

Explanation:

You might be interested in
What a makes butterfly so special?
sveta [45]
Wing’s of butterfly’s are unique
It’s ability to change its form.
3 0
3 years ago
Read 2 more answers
I need help please!! | No links please !
hodyreva [135]
Trees are very important natural resources. They are the source of food, shelter and habitat. We get various woods, timber , fodder from the forest. Trees hold the soil firmly. Forests helps in conducting water cycle. If trees are cut down then environmental pollution will increase because trees purify the Air. Land pollution , air pollution , water pollution may increase. Biodiversity can be affected.
4 0
3 years ago
Explain why polygenic traits are expressed through quantitative variation, using skin color as an example.Explain incomplete dom
Alexxx [7]

Answer:

Polygenic traits are quantitative because their phenotype expression depends on several different alleles found on different chromosomes.

Explanation:

ON EDGE

8 0
3 years ago
Which organism impacts their environment the most?
Vlad [161]

Explanation:

What environment is it?

4 0
3 years ago
What are the reactants of cellular respiration?
tia_tia [17]

Answer:

Explanation:

‍♂️

6 0
3 years ago
Read 2 more answers
Other questions:
  • Secondary structures are stabilized by which type of interaction?
    8·1 answer
  • Which best describes red blood cells?
    8·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • One characteristic shared by a virus and a living cell is that both ?
    8·1 answer
  • How did the bonds between each subunit form in starch?
    10·1 answer
  • Consuming alcohol inhibits the release of ADH. As a result __________.
    12·1 answer
  • HELP
    10·1 answer
  • HURRY PLEASE. List the four types of organic compounds found in all living things and explain why they are important.
    13·1 answer
  • O
    15·1 answer
  • Help me please help ​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!