B. The brain reacts to excessive dopamine levels by increasing the number of dopamine receptors.
Answer:
Blank 1 is option 2 and blank 2 is option 1
Explanation:
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
a. derivatives of triacylglycerols that contain a polar phosphate head and an amino alcohol at one of the positions of the glycerol group.
Explanation:
Glycerophospholipids consist of glycerophosphate which is an ester of glycerol and phosphoric acid, long-chain fatty acids, and certain alcohols. The glycerophospholipids is responsible for the formation of cellular membranes of organelles within cells of all organisms. The name of Glycerophospholipids indicates the presence of glycerol, phosphorus and lipids so that's why we can say that it is derivatives of triacylglycerol that contain phosphate and an amino alcohol at one of the positions of the glycerol group.
Standard of living refers to the quality, and quantity, of goods and services made available to an individual for his/her consumption. This definition is a general one and is easily understood.
To improve one's standard of living, in accordance with this definition, one needs to be provided with a better quality goods & services , such as advanced electronics and gadgets, or quantity, such as producing more self-care product for consumption.
So how does this conflict with his/her environmental concerns? In order to improve standard of living, there is a few trade offs. To produce more quantity of goods & services, more resources have to be used. This might lead to excessive usage, wastage & depletion of natural resources. For example, to provide more fuel to the society, companies have to extract more & more of fossil fuel. Sustainable usage of natural resources might be a concern, since some types of resources are unrenewable e. g oil & gas.
Production of higher quality products requires advanced state of technology. In the meantime, the use of some technologies aren't exactly environmental friendly i. e it may create pollution. For example, decades ago, manufacturing shirts using traditional methods might not yield consistent results thus the invention of machine helps with increasing the quality, however, results in noise and air pollution. Another example, using air-conditioning instead of hand fan is more effective in coping with hot weather, but greenhouse gas is emitted.
This shows the conflict between environmental concern and the desire to improve standard of living in general.
Hope this helps!
