1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
3 years ago
7

How does CO2 enter a plant?

Biology
1 answer:
sweet [91]3 years ago
5 0
Carbon dioxide<span> from the air goes into their leaves and thats how plants get carbon dioxide.</span>
You might be interested in
How does an enveloped virus gain/obtain/get its envelope?
Arte-miy333 [17]

Answer:

The envelope come from the host cell membrane as the virus leaves the host cell

Explanation:

A virus is an organism that is incapable of replicating on its own without infecting a living host. A virus consists of a genetic material (DNA or RNA) , a protein coat called CAPSID, and sometimes some viruses possess an envelope, which is an outer covering or enclosure. Viruses that possess this envelope are referred to as ENVELOPED VIRUS.

The virus lacks the ability to produce any structure, hence, they gain this envelope made of phospholipid from the cell membrane of the host they infect. During the infection cycle of a virus, a process called budding enables a portion of the host's plasma membrane to cover or encapsulate the virion cells, hence, making them enveloped in the process.

8 0
3 years ago
State one reason why an individual’s pulse rate increased during exercise.
shusha [124]
Blood needs to flow faster around the body in order to supply the muscles with oxygen for respiration
4 0
2 years ago
Which of the following statements must be *FALSE*?
Elan Coil [88]
Hhhhhhhhhhhhhhhhhhhhh
3 0
3 years ago
Describe the effect of increasing phosphorus levels on producers.
lutik1710 [3]

Answer:

too much phosphorus can slow down the growth of a plant.

Explanation:

Excessive soil phosphorus reduces the plant’s ability to take up required micronutrients, particularly iron and zinc.

7 0
2 years ago
he typical human adult uses about 160 g of glucose per day, 120 g of which is used by the brain. The available reserve of glucos
evablogger [386]

Answer:

In humans, the major precursors from which glucose can be synthesized from are:

1. glycerol from triacylglycerols

2. glucogenic amino acids from protein.

3. Oxaloacetate formed from CO2

4. Pyruvate foem pyruvate carboxykinase

All there's are routes through which the body obtains glucose to replenish body glucose levels

3 0
2 years ago
Read 2 more answers
Other questions:
  • The cytoplasm has a reducing environment, while the extracellular space tends to have an oxidizing environment. Based on this in
    8·1 answer
  • Which of the following apply to food webs? Select all that apply
    6·1 answer
  • Use the structure of a water molecule to explain why its is polar
    9·1 answer
  • An insured has endured multiple surgeries and hospitalizations for an illness during the summer months. Her insurer no longer bi
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Why did Mandel study P plants
    8·1 answer
  • Bear in mind the biological definition of a species and also the appearance and distribution of the named populations of Ensatin
    9·1 answer
  • Nucleus is found in...<br> A. prokaryotic cells.<br> B. eukaryotic cells.<br> C. all cells.
    9·2 answers
  • NO LINKS AS AN ANSWER!!!!
    6·1 answer
  • Make a water filter,make some changes and then answer these questions.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!