1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
14

What do you expect to happen if you increase the amount of greenhouse gases in the atmosphere?

Biology
2 answers:
Valentin [98]3 years ago
8 0

"thank for the points"

Finger [1]3 years ago
7 0
. Too much of these greenhouse gases can cause Earth's atmosphere to trap more and more heat. This causes Earth to warm up. Hence global warming.
You might be interested in
Which best describes pnf stretching?
Viktor [21]
The answer to the question is letter d
7 0
4 years ago
Please define the terms, don’t copy and paste. I’m giving 15 points for it
iren2701 [21]
Algae: any of numerous groups of chlorophyll-containing, mainly aquatic eukaryotic organisms ranging from microscopic single-celled forms to multicellular forms 100 feet (30 meters) or more long, distinguished from plants by the absence of true roots, stems, and leaves and by a lack of nonreproductive cells in the reproductive structures: classified into the six phyla Euglenophyta, Crysophyta, Pyrrophyta, Chlorophyta, Phaeophyta, and Rhodophyta.

Amboeda: any of a large genus (Amoeba) of naked rhizopod protozoans with lobed and never anastomosing pseudopodia, without permanent organelles or supporting structures, and of wide distribution in fresh and salt water and moist terrestrial environments

Asexual reproduction: reproduction (as cell division, spore formation, fission, or budding) without union of individuals or gametes

Cilia: minute short hairlike process often forming part of a fringe

Diatom: any of a class (Bacillariophyceae) of minute planktonic unicellular or colonial algae with silicified skeletons that form diatomaceous earth

Please mark brainliest
7 0
3 years ago
BIOLOGY PLS HELP AND BE HONEST!!
krek1111 [17]

Answer:

D kbxbjxkxlxjjxkxjxjxhbxbxbcjckfk

6 0
3 years ago
Read 2 more answers
Explain why you think the current model of the atom will or will not change over time ?
KiRa [710]

I think it will change, because over the years they have found different ways to show the atom, and different discoveries. We always have a new chance to discover something new about the atom.

3 0
3 years ago
Read 2 more answers
A body of underground water, usually comprised of water saturated regolith, is permeable, and replenishes lakes and streams, is
Illusion [34]

A body of underground water, usually comprised of water saturated regolith, is permeable, and replenishes lakes and streams, is known as a aquifer.

Groundwater to be able to get into a rock with good porosity it must also have good permeability. For a rock to be permeable and for water to move through it, the pore spaces between the grains in the rock must be connected. Permeability is therefore a measure of the ability of water to move through a rock.

An aquifer is a body of rock and/or sediment that holds groundwater. Groundwater is the word used to describe precipitation that has infiltrated the soil beyond the surface and collected in empty spaces underground. There are two general types of aquifers confined and unconfined.

To learn more about Groundwater  , here

brainly.com/question/10005777

#SPJ4

3 0
2 years ago
Other questions:
  • Help! will mark if answered asap and correctly
    11·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How are food and water shortage related to pollution
    10·2 answers
  • Transcription: Transcribe the DNA to make an mRNA molecule ATGA ACCATTCAGTATG Gb| Complimentary DNA mRNA Molecule​
    11·1 answer
  • How did the occurrences of the different traits change over the 30-year period? Use evidence from the graph to support your answ
    12·2 answers
  • ___ all of the different types of plants and animals in an ecosystem​
    6·1 answer
  • What is a phenotype?
    6·2 answers
  • These aliens can be either green or purple. The dominant trait is green, and the
    12·2 answers
  • What event starts the Krebs Cycle?
    7·2 answers
  • Describe a spring tide and how does high and low tide change during a sprint tide?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!