1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
15

How to write 778,000,000 in scientific notation

Biology
2 answers:
Anestetic [448]3 years ago
8 0

To answer the question what is 77800000 in scientific notation let’s recall how to convert 77800000 to scientific notation as detailed on our home page.

When you split the number 77800000 into a coefficient and a power of 10 you do get 77800000 in exponential form, but there is an indefinite number of possibilities.

As you probably want 77800000 in normalized scientific notation, the coefficient or significand of 77800000 in scientific notation must be in the interval [1,10[.

As there are many ways to express 77800000 in scientific notation, in this post we mean 77800000 in normalized scientific notation, unless stated otherwise. Therefore:

77800000 in scientific notation = 7.78 × 107.

Natalija [7]3 years ago
3 0

Answer:

yoo im just now learning about this

i think u just move the decimal right? so it would 7.8 with a power of 10^7?

Explanation:

You might be interested in
How are the effects of PKU and Tay-Sachs disease similar ?
RoseWind [281]
Tay-Sachs destroys nerve cells in the brain & spinal cord. Pku is a birth defect that causes amino acids to build up in the body. They are similar because you can get seizures from both & in both there is also slow growth. 
3 0
3 years ago
The food web shows a controlled ecosystem. The relationship between the fox and the rabbit is a ____ relationship. If the number
Agata [3.3K]
<span>The food web shows a controlled ecosystem. The relationship between the fox and the rabbit is a Predatory (predator/prey) relationship. If the number of frogs in the ecosystem decreased because of human activity, then there’s a possibility that rabbits could be overhunted .</span>
6 0
3 years ago
Read 2 more answers
As the nurse inspects the perineum of a client who is in active labor, the client suddenly turns pale and states that she feels
charle [14.2K]
The nurse priority in this intervention is to asses the patient's condition of having to feel as if she is going to faint and the sudden change of color, because this is important for the nurse to note on before the client undergoes labor because this could be dangerous or could lead to complications when not assessed before she gives birth.
8 0
3 years ago
In T. adhaerens what type of cells are responsible for movement and what is the shape of these cells?
klio [65]

Answer:

The answer is D

Explanation:

Fiber cells; cylinder-shaped

5 0
2 years ago
Read 2 more answers
(2)<br>Explain 5 reasons why both men and women become victims of violence.<br>1.2.<br>(10)​
Andrej [43]

Answer:

tghghhfhdhfhhdhshhxhhcuchfhchfjf

dhdhfhfhchhfufhfhfbfhfhxjlaoworutuiwoqirurjxbche

rgjdydiqppqieirufufhhfjfkslalqpeuyfbcbcbznmskalwifjbfbcf

sjdufuhdjaosifhhfhfndnfuff

fhdhbdbdhdjskaoakjfhfhchchcjduduucnc

7 0
2 years ago
Read 2 more answers
Other questions:
  • A rock rusting is an example of _____. NOW!!!!!!!!
    15·2 answers
  • Karie read the following definition of the term scientific method: "the series of steps that scientists use to answer questions
    6·2 answers
  • Plants capturing carbon dioxide from the atmosphere would be an example of
    7·1 answer
  • A main difference between asteroids and comets is usually NOT: a. Composition B. Size C. Appearance D. Place of origin
    9·1 answer
  • With regard to enzymes, key is to lock as
    7·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Compare and contrast<br> the different types of asexual<br> reproduction.
    11·1 answer
  • What’s your favorite car first to answer gets brainliest
    13·1 answer
  • I need help with dis too plz?
    7·2 answers
  • What happens during selective breeding?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!