1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
12

Speciation or the formation of a new species can be the result of:

Biology
1 answer:
stich3 [128]3 years ago
5 0
Speciation is the process by which new species form. It occurs when groups in a species become reproductively isolated and diverge. In allopatric speciation, groups from an ancestral population evolve into separate species due to a period of geographical separation.
You might be interested in
Which is false about osmosis and electrolyte balance in the body? when potassium enters cells, then water follows it. water trav
Mariana [72]

Answer: water travels from high to low concentration of the solute

Electrolytes are known to be major components pf body fluid and these electrolytes enter the body through foods. Thus, major regulation of body fluid and electrolyte balance in the body is through the process of osmosis. However, osmosis can be defined as the movement of water through the semipermeable membrane from lower concentration of solute to higher concentration of solute.

6 0
3 years ago
Entrainment is the ability to or not to synchronize your breathing to your walking or running step.
wlad13 [49]
True

Entrainment is to synchronize an organism to an external whole for example music or tapping.

Hope this helps!
6 0
3 years ago
Read 2 more answers
Which condition is inherited as a dominant allele?
ratelena [41]
Huntington’s disease
6 0
3 years ago
Watersheds can vary in size?<br> True<br> False
Zarrin [17]

Answer:

it is true. Watersheds can be as small as a footprint or large enough to encompass all the land

6 0
2 years ago
On​ scene, frantic family members direct you into the​ basement, where their 67dash–yeardash–old mother has shot herself in the
salantis [7]
The correct answer is "p<span>ick up the gun by the edge of the grip and carefully remove it."

Before assessing the airway, breathing, and the circulation of the trauma patient; one should first survey the scene before performing basic life support. The gun is a potential harm in doing first aid for this patient as the patient's reflexes, involuntary hand movements, or spasms can accidentally pull the trigger and hurt more people. </span>
4 0
3 years ago
Other questions:
  • Viruses are not considered living because they ________.
    15·1 answer
  • WILL MARK BRAINLIEST! HELP ASAP
    13·1 answer
  • You have isolated a particular virus and have found that the amount of thymine present in its double stranded DNA is 23%. Based
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • In the human brain, a great deal of synaptic pruning occurs in early childhood. This pruning appears to be:_______.
    10·1 answer
  • Which of these is a vascular plant ?<br> A. Fern <br> B. Hornwort<br> C. Liverwort <br> D. Moss
    5·2 answers
  • Which of the following statements about artificial erosion is true?
    10·2 answers
  • in order for electric charge to flow, there must be a difference in: current. electric potential. resistance. static electricity
    12·2 answers
  • OK SO I HAVE TO FIND WHAT THESE ARE HELP PLEASE
    7·1 answer
  • If there is a 1/2 probability of having a green seed and a 1/4 probability of having a round seed, then what is the probability
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!