1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
8

Prokaryotic cells NEVER have a nucleus A. True B. False

Biology
2 answers:
Arlecino [84]3 years ago
6 0

Answer:

The answer is A. true

Explanation:

Gelneren [198K]3 years ago
3 0

Answer:

false

Explanation:

You might be interested in
In chickens, a condition referred to as "creeper" exists whereby the bird has very short legs and wings, and appears to be creep
Aleks04 [339]

Answer Explanation:

Due to technical difficulties, the answer and explanation for this problem are available in the attached file.

Download pdf
6 0
4 years ago
All nonnative species in an ecosystem are considered invasive species.
Masteriza [31]

Answer:

The statement is false.

Explanation:

I actually had this question on a test, and I got it wrong when I put true.

3 0
3 years ago
Read 2 more answers
What are the nutrients and minerals necessary for plants to go grow and what are their functions?
tamaranim1 [39]

Answer: They are carbon, hydrogen, nitrogen, oxygen, phosphorus, and potassium.

Explanation: This is what surronds us and what that there is in plants is not as differnt from us if you think about it.

4 0
3 years ago
An exocrine gland that has an unbranched duct would be classified as a __________.
Firdavs [7]

Answer:

B) Multicellular Simple gland

Explanation:

Exocrine Glands:Glands that secrete their products onto the apical(or epithelia) surface directly or via epithelial ducts or tubes that are connected to the apical surface. These Exocrine glands are composed of highly specialized epithelial cells..

Exocrine glands can either be branched or Unbranched based on the arrangement.

*Multicellular simple glands*:Glands that have an *unbranched duct* into which cells secrete. Each secretory portion empties separately on an epithelial surface.

6 0
3 years ago
Frogs, insects, and birds living near a pond is an example of?
luda_lava [24]

I believe the best answer would be A: Community. This is because all those living things and the pond play a part for each other and in doing so they make a community.

8 0
3 years ago
Other questions:
  • Which brain structure receives information from all the senses except smell?
    14·1 answer
  • What animsl an detect sound frequency of 67,000hz
    9·1 answer
  • if scientists identify an animal with bilateral symmetry and no segmentation which phylum can it definitely not belong to
    9·1 answer
  • Why is a lumbar puncture performed between the L4 and L5 vertebrae
    14·1 answer
  • in all plant and animal cells the nucleus contains long molecules of DNA which of the following best describes the function of t
    7·1 answer
  • What happens to the activity of an enzyme as the sample is boiled at 100 C
    12·1 answer
  • Identify the stage of mitosis where the sister chromatids line up on the equator of the cell.
    13·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Where is the most energy stored in the ATP molecule stored
    14·1 answer
  • You have just trypsinized your monolayer cells growing in a T25 flask. Once detached you resuspended all of your cells in media.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!