1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady bird [3.3K]
3 years ago
13

Membrane proteins of hamster cells were marked with a blue dye and membrane proteins of human cells were marked with a green dye

. what would be seen after the fusion of the cells?
Biology
1 answer:
Luden [163]3 years ago
8 0
Fat membrane metabolic disorder facts hamster cells were marked with a blue dye and membrane proteins
You might be interested in
If Sammi had more time or better resources, how could she improve her model to eliminate some of the weaknesses?
zlopas [31]

In your question have they given sammi's weaknesses?

4 0
3 years ago
During which process is mRNA converted into a sequence of amino acids for protein production?
topjm [15]
I think cellular respiration
5 0
3 years ago
Read 2 more answers
How can a person donate blood and never run out of it?
Elanso [62]
The marrow in certain bones in your body create red blood cells, so eventually you get your blood back. The reason we need to give blood is for people, who lost to much blood to quickly to regenerate it in time to supply their body with oxygen.
5 0
3 years ago
Read 2 more answers
According to the lab safety sheet, which of the following is a potential hazard that will be present in the lab room during the
finlep [7]

Answer:

The current answer is a. Bacterial culture

Explanation:

Bacteria are used in epidemiology laboratory and bacteria can spread and cause disease if the correct lab procedures are not followed.

So according to the lab safety sheet bacterial culture is the potential hazard that will be present in the laboratory during the Epidemiology & Laboratory Techniques lab. There are different levels of biosafety according to the threat posed by the bacterial culture on which epidemiological study is going on.

The biosafety sheet helps in featuring the epidemiology of bacterial culture, transmission mode, availability of medical interventions, suggested biosafety levels, etc. So the right answer is a.

7 0
4 years ago
If a haploid sperm cell contains 8 chromosomes, it comes from an animal that has _____ chromosomes. 4 8 12 16
anzhelika [568]
A haploid cell has half the total number of chromosomes, so the animal, which has mostly diploid cells, would have 16 chromosomes. 
6 0
4 years ago
Read 2 more answers
Other questions:
  • Properties of water Classify each statement as an example of adhesion, cohesion, or surface tension. Match each statement to the
    15·1 answer
  • What’s the sun made up of
    10·2 answers
  • What is a unit of light energy? a)A wavelength
    10·1 answer
  • Enzymes are responsible for keeping body temperature at a normal range even
    11·1 answer
  • N a closed system, the momentum before a collision _____ the momentum after a collision.
    9·2 answers
  • Will water that contains no solute ever stop flowing into a hypertonic solution through osmosis?
    7·1 answer
  • Can somebody help me match them
    6·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Can someone help me with the question please.
    14·1 answer
  • Are the eyelid muscles voluntary or involuntary?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!