1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
14

5. What is another word for Lithogenous

Biology
1 answer:
AlexFokin [52]3 years ago
5 0

The answer is Marine Sediments or Sediments. Lithogenous is a sediments derived from preexisting rocks on land, it is also a type of marine sediment that forms thickest deposits worldwide, and it is sediment that begins as rocks on continents or island. An example of lithogenous sediment is sandstone.

You might be interested in
What are the characteristics of carbon bonds?
Fofino [41]

Answer:

Carbon's characteristics include its ability to bond with oxygen, hydrogen, nitrogen, phosphorus and sulfur.

Explanation:

Carbon biochemical compounds are essential to all life on the planet. Because of its bonding ability, carbon can form single, double, or triple covalent bonds with other atoms.

7 0
3 years ago
A person who is believed to speak for god​
natulia [17]

Answer:

IM SO SORRY IF  IM WRONG but i think the answer is prophets or Moses.

Explanation:

4 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Jerome and Frank both have genetic disorders. Jerome experiences weak muscles and Frank often loses his memory. Which most likel
myrzilka [38]
Frank could simply be a short-term memory loss, while Jerome could have a muscular dystrophy
6 0
4 years ago
Read 2 more answers
When (blank) is released from a (blank) neuron and binds with receptors on the motor endplate, the muscle begins to (blank)
777dan777 [17]

Answer:

Explanation:

I think it is: acetylcholine (neurotransmitter) - motor neuron - contract

second question: diffusion because of opening of ca2+ channels

6 0
3 years ago
Other questions:
  • What causes plates to move on the mantles surface?
    14·1 answer
  • 1. What information/structures were you able to glean from the Gram stain that you could not get from the methylene blue stain?
    11·1 answer
  • Alligators have internal and external development, which class might they belong to? A. Amphibia B. Reptilia C. Osteichthyes D.
    6·1 answer
  • what is the most important responsibility of individual in creating a safe environment especially on public health. ​
    6·1 answer
  • ANSWER QUICK PLEASE which statement describes what the scientist should
    10·1 answer
  • Which of the following is an indicator that a finding may be "junk" science?
    11·1 answer
  • Which is not a water quality monitoring parameter ?
    7·1 answer
  • The generation of action potentials in neurons located within the ____________ causes them to secrete their hormones
    5·1 answer
  • Easy biology question below first correct answer gets brainliest
    10·1 answer
  • Use the drop-down menu to complete the sentence.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!