1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
What could Carl Linnaeus no have used as a method of classification in his taxonomy system ?
True [87]

Answer:

i dont know thats a hard one

Explanation:

5 0
3 years ago
Plants use carbohydrates to build things such as cellulose. How do plants acquire these building blocks to build mass?
valentina_108 [34]
<span> C) They make carbohydrates through the process of photosynthesis.

</span>Photosynthesis is a process wherein light energy is converted into chemical energy. 
<span>Plants use the light energy coming from the sun and make food and other cellular organic compounds that will be used for certain types. 

</span>
7 0
3 years ago
Stone and brick used as exterior siding needs _______________, while vinyl is _______________ and can be attached directly to th
Ber [7]

In contrast to vinyl, which is lightweight and can be affixed directly to the framing, stone and brick need support when used as external siding.

<h3>Why do people frame works of art?</h3>

The way we experience art can be greatly influenced by the frames. They can be crucial in safeguarding the artwork in addition to improving how it looks. Some frames may even increase the value of the art that is displayed inside them.

<h3>What Is a Frame?</h3>

Art that has been framed has been mounted inside of a picture frame, usually behind glass. Fine art, art prints, antique posters, photographs, or any other piece of artwork can be protected against UV rays, water, dust, and scratches by framing.

<h3>Describe framing.</h3>

The arrangement of visual components in an image or layout in relation to the primary subject is known as visual framing.

learn more about framing here

<u>brainly.com/question/15740232</u>

#SPJ4

6 0
2 years ago
One positive use of viruses is their function as
Viktor [21]
Phages are a positive use of viruses
4 0
3 years ago
What elements are typical of a stable society?
lara31 [8.8K]
<span>Water, energy, and shelter are basic resources that everyone needs to survive. Active participation from all members</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • How do immunoglobulin genes code for a seemingly infinite variety of antibodies?
    8·1 answer
  • Both frogs and ducks have webbed feet. However ducks are more closely related to perching birds than to frogs.
    15·1 answer
  • After the DNA zips itself back up into a double helix, what does the mRNA do
    10·1 answer
  • What does agglutination mean in blood typing?
    13·1 answer
  • Match the following.
    6·1 answer
  • A combined sewer system carried___ to a sewage treatment plant. A. Household waste water B. Rain water C. Lawn run of D. All the
    5·1 answer
  • Transpiration is one part of the
    13·1 answer
  • How does energy move in a healthy ecosystem from the sun to the plants and animals?
    9·2 answers
  • Which is true about sex-linked traits?
    14·1 answer
  • PLEASE HELPPPP I don’t understand this one
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!