1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
"susan is consuming 70 grams of protein per day on her 2,000-kilocalorie-per-day diet. what percent of susan's diet is protein?"
nirvana33 [79]
The answer to this question would be: 14%
Protein will give a calorie about 4kcal/gram. Then, the total calorie of protein from Susan meal would be: 70 grams * 4kcal/g= 280 <span>kilo calorie</span>.
To find the percentage you will need to divide the total calorie diet with the protein calorie. The calculation would be:

protein percentage= protein calorie/ total calorie 
protein percentage= 280kcal / 2,000kcal = 14%
6 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which of the following is the secondary principle of proportion?
musickatia [10]
B. Depth creates the overall weight and more something is to be measured
8 0
3 years ago
Do pandas blink? If so why or why not?
In-s [12.5K]
Pandas only blink sometimes because they are looking out for danger most of the time. Like other mammals, they have an upper and lower eyelid, so yes they do blink, but not as much as humans.

8 0
4 years ago
Read 2 more answers
which is an example of biodiversity 900000 fires, deforestation, thousands of species carbon dioxide?
stira [4]

Answer:

Thousands of species is an example of biodiversity.

<u>Explanation: </u>

<em>Biodiversity is the short term for biological diversity which was coined by E.O. Wilson</em>. <em>Biodiversity refers to all the species of plants (flora) and animal Kingdom (fauna) present on the Earth.</em> It covers different types of ecosystems present in a well-defined area whether it be terrestrial or aquatic and the genetic variability within a species.

The variety of crops and livestock present on Earth have played a great role in human development. Without them, life would not be possible. That’s why it is our moral duty to conserve our biodiversity. If we preserve it for our future generations, we will survive.  If they are overused or misused, the entire food chain would perish.

4 0
4 years ago
Other questions:
  • What are the roles of fungi? Check all that apply.
    7·2 answers
  • What is malaria?biology
    8·1 answer
  • A certain species of desert lizard digs tunnels in which to lay its eggs. The eggs must incubate inside the tunnel for several w
    10·1 answer
  • Which of the following is a possible scenario that could lead to a new species? A tree frog needs to jump higher to escape preda
    13·2 answers
  • Thermoregulation is a specific type of homeostasis where certain higher animals must maintain their internal body temperature. T
    8·2 answers
  • A microbiologist wants to study the virus particles from a urine sample, but not any bacteria that might be present. How can the
    9·1 answer
  • What effects do you think this change in the speed of the ocean currents cold have on living things in the ocean
    14·1 answer
  • As much as 25 percent of the fruits and vegetables grown in
    12·2 answers
  • Does the model provide above represent a correctly balanced chemical equation
    7·1 answer
  • Which method of timber harvesting removes all trees from the harvest area?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!