1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
Which hypothesis suggests that ancestral vertebrates may have evolved from urochordate larvae?.
Anastaziya [24]

Garstang's Auricularia hypothesis suggests that ancestral vertebrates may have evolved from urochordate larvae.

What is Garstang's Auricularia?

The auricularia hypothesis, proposed by Garstang was an attempt to explain how the chordate body plan originated from a deuterostome common ancestor by emphasizing the significance of changes in larval forms. According to the Garstang Hypothesis, development of sexual maturity in a non-metamorphosing lineage of tunicates might provide the immediate proto-chordate ancestors of more typical chordates.

Learn more about Garstang's Auricularia here:

brainly.com/question/29576544

#SPJ4

7 0
1 year ago
What changes in agriculture have increased the potential for water pollution
Vinvika [58]

small chicken farms turned into factories because it was cheaper to  

maintain and it also made it cheaper for people to buy eggs. However  

this produced a huge problem of what to do with the chicken manure  

and this is also a problem amongst other types of livestock as well as well as factories having big oil spills hope this helps sorry didnt know what you wanted for a answer

7 0
3 years ago
Which particle has a high rate of deposition?
fenix001 [56]
The answer is a low-density particle
5 0
4 years ago
Read 2 more answers
Select the correct answer.
aleksklad [387]
I would pick A hope it’s correct
4 0
3 years ago
Read 2 more answers
The type of wound healing that occurs when a wound is sutured is _______ healing.
Tju [1.3M]
Secondary Closure or Second intention
7 0
3 years ago
Other questions:
  • PLEASE ANSWER THE MIDDLE 2 ROWS. 13 points
    15·1 answer
  • What two parts of the brain are most involved in explicit memory?
    7·1 answer
  • ASAP ⚠️
    8·1 answer
  • Are prokaryotes unicellar ?
    11·2 answers
  • What group contains only organs in a human body?
    5·2 answers
  • Blood moves from arteries to veins through tiny blood vessels called
    8·1 answer
  • How do The thickness and darkness of glass affect the amount of light that is transmitted
    8·1 answer
  • IMP is the metabolic intermediate where purine biosynthesis branches for synthesis of
    11·1 answer
  • Can anyone help me write hard questions that you may have about Photosynthesis &amp; Cellular Respiration? (This is for a survey
    13·1 answer
  • Describe the mechanisms<br> by which enzymes lower<br> activation energy
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!