1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
If you are unable to see the road ahead while driving through heavy rain or fog, and your wipers do not help, you should:
bonufazy [111]
If you are unable to see the road ahead while driving through heavy rain or fog, and your wipers do not help, you should p<span>ull off the road completely until visibility improves.
This is the wisest thing to do in such conditions, if you want to avoid having a car accident. If you cannot see ahead of your car when it is raining or foggy, you should avoid driving, because you may injure yourself or somebody else.
</span>
6 0
3 years ago
Which component in a graph indicates an independent factor?
castortr0y [4]
On a bar graph, the x axis represents the independent variable and the y axis the dependent variable. 


3 0
3 years ago
What is carotenoid pigment
andrey2020 [161]

Answer:

Carotenoid, any of a group of non nitrogenous yellow, orange, or red pigments (bio chromes) that are almost universally distributed in living things. There are two major types: the hydrocarbon class, or carotene, and the oxygenated (alcoholic) class, or xanthophylls. Synthesized by bacteria, fungi, lower algae, and green plants, carotenoids are most conspicuous in the petals, pollen, and fruit (ex: carrots, sweet potatoes, tomatoes, and citrus fruits) of the flowering plants.

Explanation:

6 0
3 years ago
This is the solid layer of the earth. It includes the crust and the lithosphere.<br> lol
RideAnS [48]

lolololololololololololololololololololololololololololololololololol!!

5 0
3 years ago
Read 2 more answers
Which was Charles Darwin’s contribution to the study of biology?
12345 [234]

Answer:

Darwin's greatest contribution to science is that he completed the Copernican Revolution by drawing out for biology the notion of nature as a system of matter in motion governed by natural laws. With Darwin's discovery of natural selection, the origin and adaptations of organisms were brought into the realm of science.

Explanation:

;)

6 0
2 years ago
Other questions:
  • In what type of court would a justice of the peace handle minor criminal cases, less serious civil suits, and traffic/parking vi
    9·1 answer
  • A threadlike structure of dna that carries genes is called
    12·2 answers
  • What are the Significance Of Helicase Enzymes During DNA replication?
    15·1 answer
  • Habitat vs. Niche Group Activity
    10·2 answers
  • Which of the following do yeast produce during fermentation
    7·1 answer
  • Liquids that evaporate quickly are called what?
    14·1 answer
  • Why is it important to follow the steps of washing your hands
    15·2 answers
  • (GIVING BRAINLIEST!!)
    9·2 answers
  • You're smart, thanks so much and do you know the missing answers to this: The Endothelial cell lining a ANSWER adjacent to a sit
    10·1 answer
  • What is the name of the process that happens in the mitochondria?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!