1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
In the formation of ltp, the entry of ca2 iond inyo yhr neron activates, which are enxymes that contribute to the:_____.
Aliun [14]

In the formation of LTP, the entry of Ca2+ ions into the neuron activates protein kinases, which are the enzymes that contribute to the increased AMPA conductance of the postsynaptic cell.

<h3>What is LTP?</h3>
  • LTP or Long-Term Potentiation is a biological process due to which synaptic connections formed between different neurons grow stronger due to frequent activation.
  • It can be defined as a way by which the responses of brain change along with the experience thus dealing with learning and memory in the hippocampus.
  • It is caused by combining activity of presynaptic and postsynaptic neurons.
  • During synapses, Ca2+ is release as a neurotransmitter from the presynaptic neuron. This Ca+ enters the postsynaptic neuron and activates protein kinases.
  • The protein kinases increase the activity of AMPA receptors which plays an important role in neurotransmission through glutamate.

Learn more about LTP here:

brainly.com/question/14879971

#SPJ4

8 0
1 year ago
In one sentence describes each layers of the earth .
Luba_88 [7]
They are all layers of the earth
8 0
2 years ago
Read 2 more answers
Soil is a mixture of _______.
BigorU [14]
Soil contains of minerals(solid), moisture(liquid), oxygen (gas), and many other components. So it is a mixture of <span>b. solids, liquids, and gases</span>
5 0
3 years ago
Read 2 more answers
High-and-Low air presure areas leading to air movement happens when there are differences in which factor???
erica [24]
When there is density it controls the high and low pressure the answer is A
8 0
3 years ago
Read 2 more answers
What statement BEST describes sound? A) It's a form of work. B) It's a type of force. C) It's a form of energy. D) It's a type o
RSB [31]

A) It's a form of work.

8 0
3 years ago
Read 2 more answers
Other questions:
  • "why is it necessary to phosphorylate a glucose molecule, creating glucose-6-phosphate
    11·1 answer
  • Which enzyme is active over the largest temperature range
    13·1 answer
  • What type of skeleton (ENdoskeleton, EXoskeleton, or None) do sponges have
    11·1 answer
  • What organ releases glucose to help maintain normal blood glucose levels?
    5·1 answer
  • What is the purpose of transcription?
    15·2 answers
  • ______________ fats, such as olive oil and sesame oil, are produced in plants and are liquid at room temperature.
    14·2 answers
  • 7. What is a hotspot?
    10·1 answer
  • When giving care to an individual with an open bleeding wound priority# 1 is to
    8·2 answers
  • Pls help me thx alot​
    15·1 answer
  • HELP!!!!!!!!! points and brainiest will be rewarded^^
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!