1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
Which two phenomena are evidence that gravitational forces are attractive? Select two statements.
Vinvika [58]

Answer:

A. the rise and fall of the tides.

C. a dropped object always falls toward Earth.

Explanation:

Gravity is considered to be a universal force of attraction which acts between all objects that has both mass, energy and occupy space. Therefore, it acts in such a way as to bring objects together.

Additionally, the gravity of earth makes it possible for all physical objects to possess weight.

The two phenomena which are evidence that gravitational forces are attractive includes;

I. The rise and fall of the tides: this is caused as a result of the gravitational force of attraction exerted by the moon on earth.

II. A dropped object always falls toward Earth: this acceleration is due to the gravitational force of attraction between the Earth and the object.

7 0
3 years ago
I nee help brinlist i will give it to you
Montano1993 [528]

Answer:

A

Explanation:

The energy carried by electromagnetic waves is sometimes referred to as radiant energy. Electromagnetic waves do not require a medium for propagation hence they can travel through vacuum and are known to transmit enormous amount of energy.

Electromagnetic waves transmit energy away from the source of the wave. Hence the answer chosen in the answer section above.

3 0
2 years ago
School is school good for you
myrzilka [38]
Yes it is, He gives you a good education to prepare you for life
5 0
2 years ago
Read 2 more answers
What is a colloid solution?
ZanzabumX [31]

Answer:

Colloids or colloidal solutions are mixtures in which microscopically dispersed insoluble particles of one substance are suspended in another substance. The size of the suspended particles in a colloid can range from 1 to 1000 nanometers (10-9 meters).

Hope it helps........

8 0
2 years ago
In a human, one set of chromosomes= 23 chromosomes. How many chromosome would you find in each of the following cells?
lora16 [44]

Answer:

The answer is A) You would find 46 chromosomes in a Haploid cell and B.) You would find 23 chromosomes in a Diploid cell.

Explanation:

A human haploid cell, such as a skin cell, is a complete unit. It is capable of duplicating itself and the new cell has exactly the same number of chromosomes, which is 46.

A human diploid cell, such as a human egg cell, has half the number of chromosomes, which is 23.

Hope this helps!! Have an Awesome day!!! :-)

3 0
3 years ago
Other questions:
  • Caffeine is also a what?<br> A. Opioid<br> B. Narcotic<br> C. Barbiturate<br> D. Psychoactive
    7·1 answer
  • Greater biodiversity exists closer to earths equator then in areas closer to earths poles
    13·1 answer
  • Major subdivisions of the biosphere are
    9·1 answer
  • The point below ground from which an earthquake's energy is released is called the focus. An earthquake's epicenter is located
    8·2 answers
  • Oil spills often kill many plants and animals in the affected area. What is the consequence of these mass die offs?
    15·2 answers
  • Which of the following is an example of passive transport??
    12·2 answers
  • Identify different carbon pools.
    8·2 answers
  • What happens when boiled liver is added with hydrogen peroxide?
    6·1 answer
  • PLSSS HELPPPPP <br> What is the difference between a food web and a food chain?​
    5·1 answer
  • 8. Calculate Cell A normally divides once every two days. If its control mechanisms aren't working correctly, cell A divides six
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!