1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
Well labeled diagram of a tapewom
Zolol [24]

Answer:

I hope this is something like what you're looking for

5 0
3 years ago
Tiny opening in the leaf that allow carbon dioxide to enter are called
stepladder [879]
The correct answer is B. Stomata
5 0
3 years ago
Read 2 more answers
Which of the following should be given to students before they begin a laboratory experiment?
Bogdan [553]
The answer is B. guidelines for safe laboratory practices
7 0
3 years ago
Can someone plz help me with this asap.
hjlf
The answer to your question is D
3 0
3 years ago
Read 2 more answers
(WILL MARK BRAINIEST)Which is required for both anaerobic respiration and aerobic respiration? A:oxygen B:water C:mitochondria D
Burka [1]
Glucose is required for both aerobic and anaerobic respiration.
5 0
3 years ago
Read 2 more answers
Other questions:
  • The model stating that organic molecules present in ancient seas lead to the formation of life’s building blocks was the.... 1.b
    9·1 answer
  • 1. How is the process of photosynthesis central to sustaining life on Earth?
    8·1 answer
  • How much of the worlds water is saltwater? A. 97.5%. b. 50% C.25% D. 2.5%
    13·2 answers
  • What are animals everywhere doing in solidarity with the animals of animal farm?
    15·2 answers
  • true/false. The pacific northwest is home to a temperate rain forest, where over 300 centimeters of rain falls yearly
    10·1 answer
  • One of Mendel's Laws of Inheritance. This law states an organism has two different alleles for a trait and the allele that is ex
    7·2 answers
  • Which of the following elements is NOT located in Period 3?
    5·2 answers
  • Suppose you are a scientist trying to help people who cannot produce an enzyme needed for proper digestion. How could you use ge
    9·1 answer
  • Name the organelle that perfoms each of the following function in acell protain synthesis​
    11·1 answer
  • 1. Why does the angle of the sun at noon seem to change at different months throughout the year?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!