1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
The name of an enzyme usually ends in
Kazeer [188]
The names of most enzymes end in "-ase." Some enzymes which have been known longer have older names that don't end in "ase." For example: pepsin, trypsin, and chrymotrypsin which are all enzymes localized in the digestive tract. hope u got the point
7 0
3 years ago
The body uses atoms in different ways to accomplish different tasks. for example, one portion of the body's calcium supply stren
V125BC [204]
Where are the statements?
3 0
3 years ago
If 1 mole of NaCl is dissolved to form 0.5 liter of solution, what is the resulting concentration of the solution?
svetoff [14.1K]
The answer to this question is 9.1
4 0
3 years ago
The snapping turtle shown above, lives in a small farm pond, where its major prey is largemouth bass. In turn, the bass primaril
LUCKY_DIMON [66]
One snapping turtle weighs 40 pounds, so 10 snapping turtles in a pond have a total weight of 400 pounds. The turtles eat largemouth bass (1 trophic level below them), and the bass in turn eat minnows (2 trophic levels below the turtles). So since only 10% of energy is passed in each trophic level, we would need:
(x lbs of minnows)(10%)(10%) = 400 lbs of snapping turtles
x = 40000 lbs of minnows (Choice C)
3 0
3 years ago
Read 2 more answers
An air temperature of -18C is equal to
meriva

Answer:

-0.4 F  

255.15K

Explanation:

3 0
3 years ago
Other questions:
  • Why is dna called the "double helix"? select one:
    13·1 answer
  • Which structures are parts of the central nervous system? Select all that apply.
    8·1 answer
  • Why do you think a growing human population means a mass extinction event for Earth’s animals? Cite your evidence.
    10·1 answer
  • Explain biodiversity
    15·1 answer
  • Chapter 8 Section 1: How Organisms Obtain Energy​
    11·2 answers
  • what is the name of the cycle that converts inorganic carbon dioxide into a carbohydrate molecule a plant can use​
    7·1 answer
  • What are the basic cell structures that impacts diffusion?
    7·1 answer
  • Diffusion in membrane cell
    13·2 answers
  • What do both the theory of evolution and the cell theory have in common as scientific theories? (2 points) Both have strong scie
    6·1 answer
  • A. puberty
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!