1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
Causas, consecuencias, prevencion y medidas de solucion sobre la falta de agua en el mundo
m_a_m_a [10]
Http://www.madrimasd.org/blogs/remtavares/2010/05/28/131465

<span>Creo que este sitio web puede ayudarle.</span>
6 0
3 years ago
Which is an example of an inherited trait?
Serjik [45]
Eye color, hair color, straight or curly hair, dimples, freckles. Any physical appearance.
5 0
3 years ago
Trisomy could occur as a result of nondisjunction during meiosis. In order for nondisjunction to lead to trisomy, how many chrom
babunello [35]

Answer:

24 (n+1)

Explanation:

Trisomy refers to the presence of one extra chromosome in the genome of the organism. This means that the affected individuals have a total of 47 chromosomes, instead of 46.  

Nondisjunction during meiosis I or meiosis II produce the gametes with one extra chromosome. For example, nondisjunction in egg mother cell results in the production of some egg cells with "n+1; 24 chromosomes".  

Fertilization of the egg cell carrying 24 chromosomes with a sperm carrying 23 chromosomes forms a trisomic zygote with 47 chromosomes.  

5 0
3 years ago
Read 2 more answers
The cell walls of a plant consist mostly of cellulose, a carbohydrate, which provides a strong structure. The cell membrane gets
blsea [12.9K]

Answer:

Common to all plant species, the cell wall is the tough outer coat that protects the plant cell. The cell wall is mostly carbohydrate‐based, comprising three major classes of polysaccharides: cellulose, hemicellulose and pectin. There are also important structural proteins as well as phenolic and aliphatic polymers.

Explanation:

7 0
3 years ago
Which cells are responsible for attacking, adhering, engulfing, and digesting foreign bodies?
7nadin3 [17]

Phagocytes are cells that protect the body by ingesting (phagocytosing) harmful foreign particles, bacteria, and dead or dying cells
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is the first key to reducing the risk of exposure to bloodborne pathogens?
    12·2 answers
  • A man's body washes up on a Florida beach. Some teen-agers find the body as they are walking along the beach. There doesn't seem
    6·1 answer
  • Regulating the manufacture of _____ is the function of RNA.
    9·2 answers
  • If some of the synapses onto a cell have been highly active and others have not, only the active ones become strengthened. this
    10·1 answer
  • What are the basic types of neurons in the spinal cord?
    9·1 answer
  • How can you tell if a cell is an animal cell vs. a plant cell?
    12·2 answers
  • What is the meaning of salinity? A. the amount of dissolved oxygen B. the temperature of the water C. the amount of dissolved sa
    11·1 answer
  • From food.<br> Respiration is the process in which organisms use oxygen to release from ____ food
    15·1 answer
  • Democracy And human rights
    13·2 answers
  • Which is likely to happen to a plant if it starts losing more water than it can take in?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!