1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
In your own words, explain why the direction along which the electromagnetic wave travels is not the same as the direction along
Burka [1]
 i dont kno this one hasha
5 0
3 years ago
Read 2 more answers
Would the left or right ventricles of the pig heart have more cardiac muscle? explain.
alex41 [277]
I am pretty sure a pigs heart has the same structure as a human heart so in saying this the if i remove correctly the right side has more muscle as it has to provide blood to most of the body not including the lungs
7 0
3 years ago
Some plants have reproductive structures that help them reproduce using natural forces or animals. How does the reproductive str
mario62 [17]

Answer:No

Explanation:Plants will not just have to rely on one animal to help reproduce. Plants can mimic things such as scents or looks to be an incentive for other animals. Wind and water can also help transport pollen. Plants always have pollinators such as wind, water, insects, and animals. Plants use mimicry in order to attract the biotic pollinators. Plants will never have trouble reproducing because they have so many different pollinators.

6 0
3 years ago
How do you solve balancing equations
Rainbow [258]
I'm not exactly sure what specifically you are asking for in relationship to balancing equations, but I have some examples with working out so you can examine them and try to go through the steps with them.

Hope this helps! <3

3 0
3 years ago
Describe the direction of dna replication and why that is important
vichka [17]

Answer: Roles of DNA polymerases and other replication enzymes. ... which require a template and a primer (starter) and synthesize DNA in the 5' to 3' direction. ... Topoisomerase also plays an important maintenance role during DNA replication.

Explanation:

hard to explain

3 0
3 years ago
Other questions:
  • In a Venn diagram, the separate circles contain characteristics unique to each item being compared, and the intersection contain
    15·2 answers
  • A car travels 87.96 miles in 8.73 hours. what was the speed of the car
    15·1 answer
  • The greatest source of moisture entering the atmosphere is evaporation from the surface of _____________.
    14·1 answer
  • Mitochondria are thought to be the descendants of certain alpha proteobacteria. They are, however, no longer able to lead indepe
    12·1 answer
  • What type of plate boundary occurs where two plates move away from one<br> another?
    15·2 answers
  • How has fake news affected the United states in the las year​
    11·1 answer
  • Which of the following would NOT be a density-dependent limiting factor?
    9·1 answer
  • ________ process by which carbon dioxide and other gases in the atmosphere
    13·1 answer
  • Ở đậu Hà Lan, gen A quy định thân cao trội hoàn toàn so với alen a quy định thân thấp. Cho cây thân cao giao phấn với cây thân c
    6·1 answer
  • Which hormone’s secretion is controlled by a positive feedback mechanism?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!