1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
Which pair of characteristics would you use to place a fish in one of the three fish classes: agnatha, cartilaginous fishes, or
Serhud [2]
The pair of characteristics that one must use to classify a fish is the presence of jaw and skeleton type. Agnatha fishes are also called jawless fishes and they lack bony skeletons. Cartilaginous fishes are composed of cartilage skeletons. Bony fishes have bony skeleton structures.
5 0
3 years ago
Which one of the following does not specialize in the study of bones and skeletal remains?
ANEK [815]

the answer is pathology! :)

8 0
3 years ago
Can anyone please help me?
Ksenya-84 [330]

Answer:

D

Explanation:

4 0
2 years ago
Read 2 more answers
A scientist is studying the effect of glaciers on climate and feels that the melting of ice caps has produced global climate cha
KiRa [710]

Answer:

b

Explanation:

3 0
3 years ago
What are characteristics associated with the two types of nephrons? check all that apply
svp [43]

Cortical nephrons occupy 85% of all nephrons where as Juxtamedullary nephrons make up about 15% of all nephrons. Thus, option B and C are correct.

<h3>What is Nephron?</h3>

It is the functional unit of kidneys.  Human kidneys contains around 1 to 1.5 million nephrons.

Nephrons are have two main regions, one is glomerular called as Bowman's capsule and second one is the tubular portion.

The main function are removal of waste material like solid wastes, excess water from the blood. It convert blood into the urine, reabsorb, secrete, and excrete of number of nonessential substances.

Hence option B and C are correct.

Learn more about nephron, here:

brainly.com/question/12307837

#SPJ4

Your question was incomplete. The probable question was

What are characteristics associated with the two types of nephrons? check all that apply

A. Cortical nephrons make up about 15% of all nephrons.

B. Cortical nephrons make up about 85% of all nephrons.

C. Juxtamedullary nephrons make up about 15% of all nephrons.

D. Juxtamedullary nephrons make up about 85% of all nephrons.

5 0
2 years ago
Other questions:
  • Provides great strength through parallel bundles of collagenic fibers found in tendons
    14·1 answer
  • A student conducted an experiment to test the effect of the digestive enzyme pepsin on cooked egg white and potato in the presen
    6·1 answer
  • In order to save the northern spotted owl, _______ was banned on much of the old-growth forest in the Pacific Northwest where th
    8·1 answer
  • During meiosis, the cytokinesis that follows telophase II results in
    15·1 answer
  • Guyss i need help asap plssss​
    7·1 answer
  • Having trouble with this textbook question. Can anyone help me out?
    15·1 answer
  • Collect sunlight for photosynthesis
    10·1 answer
  • Which of the following expressions is not a function of mitosis?
    7·1 answer
  • What is translation in biology
    15·2 answers
  • if someone spills very hot coffee on their skin causing great pain, which receptors would be stimulated? (choose all that apply)
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!