1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
2 years ago
10

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Biology
1 answer:
pogonyaev2 years ago
3 0

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
You might be interested in
This is the role of a species in an ecosystem, consisting of such things as what it eats, when it eats, and where it lives.
Anika [276]

Answer:

Your answer would be a <u><em>NICHE</em></u>.

Explanation:

when an animal in an ecosystem consisting of such things as what it eats, when it eats, and where it lives would be called a <u><em>NICHE</em></u>.

3 0
2 years ago
Read 2 more answers
The male reproductive glands, which produce sperm and hormones, are the
DerKrebs [107]
The testicles produce the sperm and the hormones
4 0
3 years ago
Read 2 more answers
Which of these is accomplished by the interaction of haploid cells in sexually reproducing organisms? A. deletion of genetic mat
Licemer1 [7]

The right answer is D.

A gamete is a generally haploid reproductive cell specialized in fertilization, or gamy (that is to say, able to fuse with another gamete, complementary type if necessary), in eukaryotes.

The process that carries out the fusion of two gametes is called fertilization or gamy, it is the complementary event of meiosis. Fertilization produces a new single cell, called a zygote, whose chromosome number has doubled to 2n.

5 0
3 years ago
Read 2 more answers
Is the practice of genetically modifying human cells ethical? Why or why not?
kumpel [21]

It totally depends upon whether modification is being done in somatic cells or germ cells. Somatic cells modification is ethically accepted because it doesn't pass from one generation to another generation but germline modification is considered as unethical because the modification will pass on to the next generation leading to the persistence of modification in future generations. The problem with genetic modifications is that the impacts of modifications are unpredictable, rather than being fruitful they may lead to lethal mutations so if it occurs in just somatic cells, then even if it is lethal/harmful, it will be confined to only that individual but if a lethal mutation occurs in germ cells then it will pass on to the subsequent generations and it will persist in all future generations.

8 0
2 years ago
In the United States, approximately how much water is used for
Maurinko [17]

Answer:

75%

Explanation:

The real answer is 80% and 75% is closest so uhm yea

6 0
2 years ago
Other questions:
  • Which of the following cells shows the presence of a nucleus? A.)Prokaryotic cell B.)Eukaryotic cell C.)Both prokaryotic and euk
    9·2 answers
  • Why do snakes shed their skin?
    9·1 answer
  • The process that requires an input of energy to help material move from an area of lower concentration to an area of greater con
    6·1 answer
  • The surface of the conchae are lined with ciliated respiratory epithelium is called
    5·1 answer
  • Many insects do not see into the red color-range and as a result, many insect-pollinated flowers are colors other than red (e.g.
    8·1 answer
  • The human mitochondrial genome encodes only 22 tRNAs. This limited array of tRNAs can read the 64 possible triplet codons throug
    7·2 answers
  • Please help will mark brainly!
    9·2 answers
  • Explain why weak bonds are important to living organisms
    5·1 answer
  • What form of matter is made from only one type of atom?
    8·2 answers
  • according to evolution, if I get bit by a snake and develop snake superpowers will my offspring have them too?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!