1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
11

SOMEONE PLZ HELP ASP!

Biology
2 answers:
marusya05 [52]3 years ago
4 0

Answer:

I thinks is pollution

Explanation:

its the only one that makes sense

diamong [38]3 years ago
4 0
Pollution (C.) would be the correct answer
You might be interested in
A positive sexual relationshp can
netineya [11]
D. do all of these...........
4 0
3 years ago
Explain why there is not only one correct scientific process
sukhopar [10]
There are too many different fields of science for there to be just one single scientific method<span> that all scientists follow.</span>
7 0
3 years ago
Why do the levels of GH-RH and CRH rise during the resistance phase of the general adaptation syndrome?
Alenkinab [10]

Answer:

During the resistance phase of the general adaptation syndrome, the human body undergoes a process of adaptation or tolerance to stress, which requires an increase in levels of growth hormone (GH) and cortisol, so it is observed rise the levels of GHRH and CRH.

Explanation:

General adaptive syndrome is a product of the stress to which an individual is subjected, causing a number of symptoms reflecting the loss of normal body balance, symptoms that can be both physical and psychological. This syndrome has three phases:

  • <em>Alarm phase. </em>
  • <em>Resistance phase. </em>
  • <em>Exhaustion phase. </em>

The second phase, resistance, is due to an <u>adaptation or tolerance when the stressful stimulus is maintained</u>. At this stage, an increase in blood levels of growth hormone and cortisol -which contribute to the stress tolerance process- is usually observed, increasing the bioavailability of blood glucose and endogenous steroids.

Both GHRH (somatocrin) and CRH (corticotropin-releasing hormone) are produced by the hypothalamus and activate the release of GH and adrenocorticopotrotrope hormone (CRH) by the pituitary gland, producing:

  1. <em>Increased levels of circulating growth hormone, necessary to regulate metabolism, and increase the amount of blood glucose. </em>
  2. <em>Increased levels of cortisol, from the adrenal glands, in response to stress.  </em>

In the resistance phase of general adaptative syndrome, GHRH and CRH levels increase to regulate adaptive changes that occur in the body of the individual who has it.

Learn more:

Hormonal response brainly.com/question/6337416

5 0
3 years ago
How is anaerobic respiration affect by changes in temperature ?
Paha777 [63]

Answer:

The rising temperature will increase the rate of anaerobic respiration, up to a point. Beyond that the heat will start putting a stress on the organismand the rate will go down. More heat will eventually kill the organelles.

7 0
3 years ago
Name four abiotic factors found in a prairie ecosystem? Please help me fast as you can...
Mekhanik [1.2K]
Four abiotic factors in a prairie ecosystem would be soil, climate/temperature, water, and oxygen. Hope this helps!
7 0
4 years ago
Other questions:
  • A persons height, mass, or weight will be the same on Jupiter and earth. A persons mass, height, or weight, will be greater on J
    15·2 answers
  • Collagena. is a protein.
    5·1 answer
  • 1. What is the mass number of the particle emitted from the nucleus during beta minus (B-) decay?
    9·1 answer
  • After turning the water off at the end of a shower, water still clings to your body because of
    13·1 answer
  • Describe the word difference between a chemical change and a physical change
    12·1 answer
  • What is the process of slacking?
    11·1 answer
  • Which statement about ecosystems is true
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • In prokaryotic cells, the DNA is found-
    7·1 answer
  • PLEASE HELP ME WITH THIS
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!