1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
13

Many plant pathologists believe that plant resistance is based upon the interplay of different signaling molecules? Justified.

Biology
1 answer:
liberstina [14]3 years ago
7 0

Answer:

Yes.

Explanation:

Many plant pathologists believe that plant resistance is based upon the interplay of different signaling molecules because plants have various signaling molecules that plays a great role in their growth and development. Ethylene, auxin, cytokinins, gibberellins, and abscisic acid are the growth regulators that controls the growth of plants in different conditions i.e. in resistance. These signals leads the plant to take measures in difficult situations experience by the plants so in this way the plant is resistance to the harsh environmental condition.

You might be interested in
List 5 factors that can change the flow of water through an ecosystem: As land is
postnew [5]

Explanation:

5 factors are:

1). habitat change, 4 native species, (can not survive or reproduce 2 repopulate the area).

2).physical modifications of h20, or rivers.( dam's, rivers, changing h2o flow. critical 4 native fish, water fowl, microbes that eat harmful bacteria.

3).species that are not born 2 the area

4). pollution, due 2 human modification..

5). climate change, because of human modification..

hope this helps..

8 0
2 years ago
Explain how critical thinking helps scientists analyze information for accuracy and bias.
Feliz [49]

Answer:

Critical thinking requires scientists to ask questions about information they come across and assess its validity. This facet of critical thinking helps them avoid bias that originates from personal opinion and helps them distinguish information and fact from common belief.

4 0
3 years ago
Which organelle is primarily responsible for converting glucose to atp? *.
Free_Kalibri [48]

Answer:

The mitochondria is primarily responsible for converting glucose into ATP.

Hope this helps! :)

3 0
2 years ago
If the density of water is 1 g/ml, what is the mass of 3ml of water?<br><br> PLEASE HELP
SCORPION-xisa [38]

You can use dimensional analysis to figure this out.

=3\ ml × \frac{1g}{ml}

= 3 grams

If done correctly, ml and ml will cancel out, leaving you with grams.

If you don't know dimensional analysis, simply multiply <em>3 ml</em> by <em>1 grams </em>and that should still get you 3 grams.

4 0
3 years ago
Read 2 more answers
If Harry's negligent act injures Sally, and Susan, while attempting to come to Sally's aid breaks her arm in the process then, H
kumpel [21]

Answer: Sally

If Harry's negligent act injures Sally, and Susan, while attempting to come to Sally's aid breaks her arm in the process then, Harry is liable for the harm to Sally.

Explanation:

As a mathematical expression, we can say the action of Harry H, is directly proportional to the injury to Sally S; while the mistake of Susan N is directly proportional to injury to Sally S.

So, if H = S and N = S, it is safe to say

H = N = S.

Thus, Harry negligence create room for Susan mistake, which eventually harmed Sally.

5 0
3 years ago
Other questions:
  • The graphs above show a change in distribution of beak phenotypes X Y and Z over 10 Generations. Notice that beak X completely d
    9·2 answers
  • Body chemicals that regulate sleep, moods, hunger, and stress are called "_____."
    5·1 answer
  • When the rock above a slanted fault line falls down relative to the rock underneath the fault, it is a
    6·1 answer
  • What is the difference between fault-block and unwrapped mountains?
    5·1 answer
  • Which of the following statements best explains why the cube in image b is under more pressure than the cube in image a
    12·1 answer
  • Compare and contrast earths layers
    7·1 answer
  • Where does the arrows go
    11·1 answer
  • DNA Polymerase is responsible for:
    9·1 answer
  • You wanted to prepare a fish dish for your grandfather that he loves the dried salted Codfish. But
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!