The answer is C. Cephalochordate is an animal that belongs to chordate subphylum. This species is defined by a notochord that persist throughout life. T<span>he notochord extends from their head to tail.</span>They are marine animals and has elongated bodies.
Answer: What do red signs indicate?
Red: Red generally means stop. The use of red on signs is limited to stop, yield, and prohibition signs. White: A white background indicates a regulatory sign.
Explanation:
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Answer:
The scientists could determine what are the risks to contract specific diseases, and also what are the chances of transmitting genetic disorders in next generations.
Explanation:
In this case, the scientists may determine what are the mutations that Jennifer could have and how these mutations are associated with diseases and/or genetic disorders
<h3>Hurricanes require high humidity, relatively constant winds at different altitudes, and can occur when surface ocean temperatures exceed about 79°F (26°C). The rising of warm, moist air from the ocean helps to power the storm. </h3>
<h3>Two other factors may also be contributing to the rising intensities of hurricanes.</h3>
