1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
15

PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!

Biology
1 answer:
leonid [27]3 years ago
8 0
The correct answer is c
You might be interested in
Please help... Only numbers 4,5 and 9
Alex73 [517]
4:
Independent Variable: Photosynthesis
Dependent Variable: Starch

Starch is a product of photosynthesis. Without photosynthesis, starch cannot form. Therefore starch is dependent on photosynthesis.

5:
Independent Variable: Temperature
Dependent Variable: Animal Metabolism

Animal metabolism will only be affected if the temperature of the room changes. Therefore animal metabolism is dependent on temperature.

9:
Independent Variable: Rainfall
Dependent Variable: Thickness of growth rings

The thickness of the tree's growth rings are determined by the amount of rainfall. Therefore the thickness of growth rings are dependent on rainfall.
4 0
3 years ago
The graph illustrates what has happened over an 8 year period where non-native perch were introduced into Lake Malawi in Africa.
valentina_108 [34]

Answer:

A

Explanation:

took the test

5 0
3 years ago
Read 2 more answers
When an animal confronts a "fight-or-flight" situation, the release of epinephrine promotes glycogen breakdown in the liver, hea
nika2105 [10]

Answer: and Explanation:

A.)The reason for the different products of glycogen breakdown in the two tissues is that glucose 6-phosphotase which is

a known enzyme that brings about hydrolysis of glucose 6-phosphate as a result of the creation of a phosphate group and free glucose is not available in heart and skeletal muscle, therefore,any glucose 6-phosphotase that is produced will just enters the glycolytic pathway and get converted to lactate through pyruvate, in the absence of Oxygen O2.

B) Whenever a situation involving fight or flight arises, the concentration of glycolytic precursors becomes high in order to prepare for muscular activity. Since the membrane is impermeable to any charged species, and at the same time glucose 6-phosphotase enzyme cannot be moved through the glucose transporter, then there cannot be a release of Phosphorylated intermediates from the cell. The blood glucose level must be maintained by the liver by releasing of glucose.

glucose that is later formed from glucose 6-phosphotase then enters the bloodstream.

8 0
3 years ago
Which class of enzymes catalyzes reactions involving the formation of double bonds?
vodka [1.7K]

Lyases

Lyases are class of enzymes that catalyzes reactions involving the formation of double bonds.

Lyases are class of enzymes that catalyzes the joining of C-C ( carbon to carbon), C-O (carbon to oxygen), and C-N (carbon to nitrogen) bonds by hydrolysis or oxidation. These bonds are usually held by the process of elimination which leads to the formation of new double bonds or cyclical molecules. Examples of lyases include; aldolase and adenylate cyclase.


8 0
3 years ago
Roundworms are<br><br> A.Acoelomates<br> B.pseudocoelomates<br> C.coelomates<br> D.none of the above
ollegr [7]
The answer would be A. Im sorry if its wrong

3 0
3 years ago
Other questions:
  • How is the division of the cytoplasm different in plants and in animals?
    15·1 answer
  • How does an atom become an ion
    15·2 answers
  • ________ are cognitive in nature, have an unclear, general cause, and last for several hours or days.
    10·1 answer
  • What kind of information from our world called senseory neurons detect
    11·1 answer
  • Explain how the independent alignment of homologs, and also crossing-over during the first meiotic division, each contribute to
    11·1 answer
  • Eukaryotes and prokaryotes are the two main types of cells.
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • 13. Which of these statements about particulate matter less than 2.5 microns in diameter is true?
    13·2 answers
  • Which statement is NOT true of soils?
    9·2 answers
  • A student is collecting the gas given off from a frog living in an enclosed tank. The
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!