Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Transverse waves contain crests & troughs
while longitudinal waves contains compressions &rarefactions.
Genetic engineering is applied to techniques like DNA cloning in which the steps are: step 1: DNA cutting from the parent source; step 2: DNA cut is pasted into the matrix to be modified; step 3: matrix is introduced to the host cell and step 4, vector DNA is isolated. Answer then is B.
Answer:
If the moon has grown to twice its size, the gravitational force of the Earth on the Moon would be twice as much
Explanation:
The force of gravity between two objects is doubled if the mass of one of the objects is doubled.
If the moon has grown to twice its size, the gravitational force of the Earth on the Moon would be twice as much, since the gravitational force is proportional to the masses of both the Earth and the Moon.
