1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
6

The equation shows cellular respiration. During cellular respiration, glucose combines with oxygen to form carbon dioxide, water

, and ATP.
What happens to the energy in the bonds in glucose?


The energy is transferred to oxygen.
The energy is transferred to carbon dioxide.
The energy is transferred to water.
The energy is transferred to ATP.

Biology
1 answer:
Blababa [14]3 years ago
6 0

The Answer is The energy is transferred to oxygen.

You might be interested in
What wavelength of radiation has photons of energy 5.44 x 10-18 J?
spin [16.1K]

Answer:

λ = 37 nm

Radiation is in the ultra violet region.

Explanation:

Given data:

Energy of photon = 5.44 × 10 ⁻¹⁸ J

Wavelength of photon = ?

Solution:

E = h.c / λ

λ = h. c/ E

λ = 6.63× 10⁻³⁴m² kg/s × 3×10⁸ m/s / 5.44 × 10 ⁻¹⁸ Kg m²/s²

λ = 19.89 × 10⁻²⁶ kg. m³ /s² / 5.44 × 10 ⁻¹⁸ Kg m²/s²

λ = 3.7 × 10⁻⁸ m

m to nm conversion.

λ = 3.7 × 10⁻⁸m ×10⁹ nm / 1m

λ = 37 nm

Radiation is in the ultra violet region because the rage of UV is 1 nm - 400 nm.

7 0
3 years ago
Please help meeeeeee
Natali5045456 [20]

Answer:

help you with what theres no question here??

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following diseases is the result of mosaicism in specific cells?
oee [108]
Chromosome non-disjunction, anaphase lag and endoreplication
4 0
4 years ago
Which is correct about dna replication? dna polymerase can build dna from scratch. dna polymerase adds nucleotides in the 3' to
Ivahew [28]

The correct answer is: C) the place where the parent DNA becomes unzipped during DNA replication is called the replication fork.


DNA Polymerase doesn't build DNA from scratch, rather it adds the correct nucleotides to the complementary parent strand.


DNA Polymerase adds nucleotides in the 5' to 3' direction, not the 3' to 5' direction.


DNA is made semiconservatively, meaning that there is a template strand from the parent DNA with a complementary strand being the new daughter strand.


The strand that is made continuously is the leading strand. The lagging strand is not made continuously, as it requires the use of Okazaki fragments.

6 0
4 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Other questions:
  • Sub-units of proteins are called?
    13·1 answer
  • In which organelle do most stages of cellular respiration take place?
    11·2 answers
  • A segmented viral genomea. fragments into nucleotides after infection.b. can only occur in viruses with DNA genomes.c. can facil
    10·1 answer
  • It is hoped that, despite the controversy of human cloning, biotechnology will A) have solutions for treating, if not curing, ge
    12·2 answers
  • One result of air pollution is ____________________, which is precipitation that contains more acid than normal
    5·2 answers
  • Help on these 4 questions asap
    8·1 answer
  • Explain how a ship made of materials that are much denser than water is able to float on water?
    6·1 answer
  • Which of the following is not an example of symbiosis?
    12·1 answer
  • ¿Cómo ocurre un enlace de átomos?
    9·2 answers
  • How is the word Representation used in a sentence
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!