1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
3 years ago
9

In what kingdom does the cell likely belong?

Biology
1 answer:
rjkz [21]3 years ago
8 0

Answer:

Organisms belonging to the plant kingdom are eukaryotic and multicellular organisms. They have a distinct cell wall made of cellulose. Cells are organised into true plant tissues

Explanation:

Pleaassse mark me as brainliest

You might be interested in
Under which conditions are clouds formed from ice crystals
ankoles [38]
"these clouds are composed of droplets, except during winter when they are formed of supercooled water droplets or ice crystals if the temperature at cloud level is below freezing."

hope this helps^-^
3 0
4 years ago
Protein channels allow
otez555 [7]

Answer:

I think that it is an example of a passive transport

Explanation:

4 0
3 years ago
Pls help!!!!!Provide a possible solution to reduce the damaging effects of an El Niño or La Niña event.
Elza [17]
I think the best way is to try providing helpful things that will help the humans or have people try to plant the plants somewhere that  reminds them of their old climate
I REALLY HOPE THAT HELPS I tried
3 0
4 years ago
Read 2 more answers
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
A scientist has been tracking and studying a population of deer in Yellowstone National Park. He surveys the population every si
Setler [38]
B. <span>A population of wolves was introduced into Yellowstone National Park
</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone please explain how cell membranes work. I am trying to do a assignment all about cell membranes and I dont really un
    5·1 answer
  • During transcription in eukaryotes, a type of RNA polymerase called RNA polymerase II moves along the template strand of the DNA
    15·1 answer
  • A seagull flew 145 meters to the east at a constant velocity. It flew that distance in
    14·2 answers
  • Label the water cycle diagram .
    6·1 answer
  • In which two layers does the atmosphere's tempature decrease as the altitude increase?​
    14·2 answers
  • High-level waste _____.
    10·2 answers
  • Does protein have more calories than fat
    14·1 answer
  • In humans, the DMD gene is required for proper muscle function. Mutations in the DMD gene display X-linked recessive inheritance
    15·1 answer
  • What is the role of the helicase enzyme in the DNA replication?
    12·1 answer
  • Balanced chemical equation for ethanoic acid​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!