1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotykmax [81]
3 years ago
14

Microbiology symbiosis

Biology
1 answer:
Helen [10]3 years ago
6 0

do u mean microbial symbiosis?

Answer:

Symbiosis is a relationship between two organisms

Types of Interactions

Positive interaction: Mutualism, Syntrophism, Proto-cooperation, Commensalism

Negative interaction: Ammensalism (antagonism), parasitism, predation

You might be interested in
B and T cells of the immune system have unique B and T cell surface receptors (respectively) as shown above. What is the functio
GalinKa [24]

Answer:C. There will be an increase in variety of the shape of the B and T cell receptors allowing them to recognize and destroy more pathogens

Explanation: usa test prep

4 0
3 years ago
Read 2 more answers
What is meant when we say that organisms evolve?
lisabon 2012 [21]

Answer:

It means that from time to time, organisms change in form and function

Explanation:

As organisms live, they change and develop/mutate into better, stronger, and more functional creatures. This is in addition, because of the cells in the body.

8 0
3 years ago
Antibiotics work by
OverLord2011 [107]

Answer:

c.

Explanation:

They work by killing the bacteria or slowing down its growth, they achieve this by attacking places like the wall or coating the surrounding bacteria.

7 0
3 years ago
Read 2 more answers
10 words with out pls help me God well return you the favor
lana [24]
I don't understand ur question. Hmm
7 0
3 years ago
As the human population grows what happens to our natural resource requirements
Advocard [28]
The need for natural resource should increase.
8 0
3 years ago
Other questions:
  • a small leafy branch is cut from a tree after some hours the stem remains firm but the leaves become limp suggest an explanation
    15·2 answers
  • Mesopotamian civilizations developed in the fertile valley between the Tigris and Euphrates rivers. This valley would be conside
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Identify the biochemical process occurring in this cell that produces the oxygen
    13·1 answer
  • Melissa is studying a Gram-stained slide of curd bacteria. She sees many rod-shaped, violet-colored bacteria. What type of bacte
    14·2 answers
  • A patient enters a hospital after hitting her head in a car accident. she is diagnosed with a fractured skull but has other symp
    14·1 answer
  • Are you 100% sure of the parent’s phenotypes? Are you 100% sure of Maria’s phenotype? If not, which are problematic? Why?
    6·1 answer
  • Which of the following statements is TRUE?
    10·1 answer
  • Sucrase is the enzyme that catalyzes the reaction
    14·1 answer
  • 10. What happens when a cell reproduces?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!