1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
2 years ago
12

The nucleus in a body cell of a fly contains 12 chromosomes.

Biology
1 answer:
SSSSS [86.1K]2 years ago
7 0

Answer:

it contains 6, the number of chromosomes in the gamete is half the number of chromosomes in the nucleus of the body cell.

I hope this helps

You might be interested in
T or F: Heterotrophs can produce oxygen
lesantik [10]

Answer:

False

Explanation: Heterotrophs benefit from photosynthesis in a variety of ways. They depend on the process for oxygen, which is produced as a byproduct during photosynthesis. Moreover, photosynthesis sustains the autotrophs that heterotrophs depend on to survive

8 0
2 years ago
What must happen before a chemical reaction can begin? The activation energy must be exceeded. The activation energy must be rea
irina [24]

Explanation:

For any enthalpy change in a chemical reaction, (exothermic/endothermic), the activation energy must be reached so as to break the strong chemical bonds between the reactant molecules.

9 0
3 years ago
Read 2 more answers
What is an example of an elevation change
Olegator [25]

<em>For example,</em>

<em> consider a mountain whose summit is 5,000 feet (1,500 m) in elevation, but somewhere on the way up, the trail goes back down 250 feet (76 m). ... </em>

<em>If one hikes over five hills of 100 vertical feet each, the cumulative elevation gain is 5 × (100 feet (30 m)) = 500 feet (150 m).</em>

<em />

5 0
2 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
____ is the use of nutrients to provide energy.
antiseptic1488 [7]

Answer:

The answer is D. Digestion

8 0
3 years ago
Read 2 more answers
Other questions:
  • What happens during fertilization?
    6·1 answer
  • Alleles for the same trait are separated from each other during the process of what?
    11·2 answers
  • Explain 3 stages of info flow in the nervous system, and explain how they are connected by sensory neurons, interneurons, and mo
    15·1 answer
  • 1. Imagine you have 24 hours to change into any
    13·1 answer
  • What is the study of heredity
    8·2 answers
  • uncontrolled cell division can lead to the formation of masses of cells that can remain in place called ____ tumors or ones that
    10·1 answer
  • Does acceleration have a direction?
    10·1 answer
  • Look at the pic below and tell me which one to pick
    9·2 answers
  • The chemical formula for baking soda is NaHCO3. How many sodium (Na) atoms are there in one molecule of baking soda?
    13·2 answers
  • Evaluate the extant to which the government has contributed to.social grants​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!