Answer:B..7 to the right
Explanation:
10-3=7N
Greater force of 10 means the book will move to the right.
Answer:
Senses that its too cold and turn the heat on and warm it up
Explanation:
Apples are drawn to a massive object, like the earth, and fall down under a gravitational constant. On the other hand, planets revolve around a more massive object under the same premise. It’s the same idea, just one follows a linear path, and the other has a uniform circular motion path because other forces are acting on it. In other words, the planets ARE still falling, but the sun is also pulled by them so they just keep dancing.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.