1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SCORPION-xisa [38]
2 years ago
14

The placenta is formed by endometrial tissue of the uterine lining and the ________

Biology
1 answer:
weeeeeb [17]2 years ago
7 0
Chorionic villi of the trophoblast
You might be interested in
If the lionfish population keeps rising, what would be the possible effect on the trophic levels of
Advocard [28]

Answer:

As lionfish populations grow, they put additional stress on coral reefs. For example, lionfish eat herbivores, and herbivores eat algae from coral reefs. Without herbivores, algal growth goes unchecked, which can be detrimental to the health of coral reefs.

Explanation:

4 0
3 years ago
Read 2 more answers
Which of the following is consumed by producers?
AVprozaik [17]
D, because they produce the food for the consumers, like grass.
5 0
4 years ago
If you know the answer please help me!!
Mama L [17]

Answer:

- During development similar species show similar structures. These may include tails or gills. The presence of these structures provides evidence for common ancestry.

Explanation:

I Hope this Helps :)

4 0
3 years ago
Read 2 more answers
Are viruses considered to be cells? Why or why not
GuDViN [60]

Answer:

No, viruses are not considered cells as they're parasitic and can't live on their own. A virus has to infect living cells in order to survive, so it's not considered a cell.

7 0
3 years ago
Read 2 more answers
5. In the following picture, label each of the letters<br> with what is occuring
sp2606 [1]

Answer: see explanation

Explanation:

A. substrate

B. Active site

C. Enzyme binds with substrate

D. Active site of enzyme

E. Products leaving active site

Simplified enzymatic reaction. The substrate reversibly binds to the active site of the enzyme, forming the enzyme-substrate (ES) complex. The bound substrate is converted to product by catalytic groups in the active site, forming the enzyme-product complex (EP). The bound products are released, returning the enzyme to its unbound form, ready to catalyze another round of converting substrate to product.

7 0
3 years ago
Other questions:
  • Natural forces not only blank earth but also blank blank life on earth
    13·1 answer
  • What type of molecule encodes genetic information in streptococcus pneumoniae?
    12·1 answer
  • What are some examples of producers? Why are they called autotrophs?
    6·2 answers
  • What are some characteristics of scientific questions ?
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • HELP ASAP!!!!Question 44 is an open-response question. Wild red 6 poin
    8·1 answer
  • Which part(s) of a cell is (are) most like the shipping center of a company? Which part(s) of a cell is (are) most like the ship
    8·1 answer
  • How are members of Domain Eukarya different from members of Domain Bacteria?
    5·1 answer
  • Some people are born with a heart condition in which the separation between right and left atrium is not completely closed. This
    5·1 answer
  • A scientist wants to make a DNA fingerprint, and she has used polymerase
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!