1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mart [117]
3 years ago
10

Where does Cellular Respiration occur?

Biology
2 answers:
ivanzaharov [21]3 years ago
7 0

Answer:

In the mitochondria

Explanation:

It occurs in the double-membrane organelle called the mitochondrion.

N76 [4]3 years ago
5 0

Answer:

cellular respiration occur in the mitochondria

Explanation:

it the energy factory of the cell,a double membrane bound organelle

You might be interested in
What single-use container uses the least amount of resources from environment
timofeeve [1]

A plastic cup

I'm sure this is the answer

8 0
3 years ago
Read 2 more answers
How was the Earth different 4.6 billion years ago than it is today
vfiekz [6]
The geological features were different. And humans development was different.
8 0
3 years ago
Which is the movement of nutrients such as ions or small molecules through the cell membrane in order to maintain homeostasis?
liubo4ka [24]
The answer to this is diffusion.
3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
RNA is produced by
Studentka2010 [4]

Answer:

Explanation:

rna is produced in the transcription stage of protein synthesis whereby complementary base pairing occurs

8 0
3 years ago
Other questions:
  • _____ is the mature ovary of a flower.<br><br> A. Conifer<br> B. Angiosperm<br> C. Cone<br> D. Fruit
    8·2 answers
  • Which of the following statements is true?
    11·2 answers
  • What tool can we use to predict the outcome of a genetic cross?
    5·1 answer
  • Which report helps identify which browsers may have had problems with your website?
    9·1 answer
  • Definition of condensation
    5·1 answer
  • In which type of cells would you find a permanent (Sap)vacuole: a plant or a animal cell
    10·1 answer
  • Which forms the basis of taxonomy in the twenty-first century?
    5·1 answer
  • The belief that all life came about through natural processes, mutation, and natural selection.
    15·2 answers
  • Please help me. I need the answers asap. This is due today. (ಥ﹏ಥ)
    15·1 answer
  • Welke soort cellen zitten er veel in de oranje gekleurde delen?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!