1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
4 years ago
12

n a grasshopper, all the body tissues are bathed in blood that is in the In a grasshopper, all the body tissues are bathed in bl

ood that is in the capillaries. tracheae. heart. spiracles. hemocoel.
Biology
1 answer:
defon4 years ago
7 0

Answer:

The correct answer is - hemocoel.

Explanation:

In the grasshoppers and other arthropods and some of the mollusks, there is a body cavity that contains lymph or the blood and acts as part of the circulatory system.

in grasshopper blood is restricted to vessels for a smaller part of the circulation, rest is complete its journey in the hemocoel. It is the reason the blood or lymph of insects called hemolymph.

Thus, the correct answer is - hemolymph.

You might be interested in
The first question says “Use the T chart to list at least 3 differences (Ecological Principles) between the movements of energy
Musya8 [376]

The differences between the energy flow and matter cycling depend on the number of trophic levels in the ecosystem.

<h3>What do you mean by Ecosystem?</h3>

The Ecosystem may be defined as the area or place where organisms of different species live and interact with each other in a well-defined way.

The first key difference between energy flow and matter cycling is that the energy flow shows the transmission of energy from one trophic level to the other in the food chain, while matter cycling shows the cycling of elements throughout the living and non-living parts of the ecosystem.

Energy flow always follows a fixed and definite pathway, while matter cycling randomly works in the ecosystem.

As energy moves through an ecosystem, it changes form but no new energy has been synthesized. Matters flow throughout the ecosystem, atoms are rearranged into various other molecules as per requirement but no new matter is created.

Therefore, the differences between the energy flow and matter cycling depend on the number of trophic levels in the ecosystem.

To learn more about Trophic levels, refer to the link:

brainly.com/question/20082405

#SPJ1

4 0
3 years ago
What is responsible for production of oxygen by elodea
seropon [69]
Photosynthesis is responsible
8 0
4 years ago
In which digestive organ does the digestion of fats or lipids begin?
Rudik [331]
Digestion of fats occur in duodenum which is a part of small intes tine.
4 0
4 years ago
1. (2 points) If the number of pythons increases then the death rate of marsh rabbits will
pochemuha

Answer:

Increase.

Explanation:

More predators more need for food more deaths for rabbits

4 0
3 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Other questions:
  • Cells lining the alveoli secrete a soapy substance known as:
    13·1 answer
  • Which of the following is evidence that dolphins evolved from four legged mammals not fish
    11·1 answer
  • What can a fossil tell you?<br> What can a fossil tell us about a rock?
    15·1 answer
  • What is the best description of an organism that is fit for natural selection
    11·2 answers
  • Sharks have existed on Earth for centuries, even thousands of years with very little change to their structure. Why do you think
    5·1 answer
  • A team of scientists is studying the genome of the pine tree. They have identified a gene that produces a protein that is specif
    11·1 answer
  • What causes the differences in physical characteristics like hair color among people?
    7·1 answer
  • Why do scientists use sections of dna that have little or no known functikn to do dna fingerprinting?
    14·1 answer
  • Which of the following DNA sequences is complementary to the base sequence ACCGTAT?
    15·1 answer
  • How are mass and weight different?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!