1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
3 years ago
10

How many types does the larva of silkworm moult?​

Biology
2 answers:
sladkih [1.3K]3 years ago
6 0

Answer:

there are 6 lava of silkworm moult.

tatiyna3 years ago
5 0

Answer:

Silkworms will undergo molting up to four times since they grow so much before becoming an adult.

Explanation:

You might be interested in
What does menaing of reporoducion​
netineya [11]

Answer:

It is a biological process by which an organism reproduces an offspring who is biologically similar to the organism.

Explanation:

I hope I have cleared ur doubt if not do mention in comment

5 0
2 years ago
Does a prokaryote have a nucleus
creativ13 [48]

Prokaryotes are organisms whose cells lack a nucleus and other organelles. ... Prokaryotic cells are surrounded by a plasma membrane, but they have no internal membrane-bound organelles within their cytoplasm.

sorry if i'm wrong

i'm new to brainly

3 0
2 years ago
Pyrolobus fumarii, an extreme thermophile, can survive at a temperature as high as 113°C. This microorganism could be categorize
DedPeter [7]
<span>Pyrolobus fumarii belongs to the kingdom of archaebacteria that is a thermophile which thrives at very high temperatures as much as 113 C. </span>It was  first discovered in 1997 in a hydrothermal vent where the temperature is as high as that. It belongs to the p<span><span>hylum Crenarchaeota, c</span><span>lass Thermoprotei, </span><span>Order Desulfurococcales and </span><span>Family <span>Pyrodictiaceae. Answer is B. </span></span></span>


4 0
3 years ago
Read 2 more answers
A scientist usually runs a(n) |
USPshnik [31]

Answer: Experiment.

Explanation:

Suppose that we have two related variables, A (independent) and B (dependent)

We could design an experiment where we can manipulate the value of A at will, and we also can observe how the variable B changes.

This is called an experiment, where the objective is to see how the variable B is related to the variable A, and then try to make a model that explains this relationship.

4 0
4 years ago
Can someone please help me .
Vikentia [17]
Answer: c. Enzymes slow the reaction so more products can be produced

Hope this helps :)
7 0
3 years ago
Read 2 more answers
Other questions:
  • Anyone got any ideas on what type of galaxy this is?
    7·2 answers
  • What is the definition of a gene pool
    13·1 answer
  • Why is it important to dispose of wastes from nuclear power plants carefully?
    13·2 answers
  • *Please help, I'm timed*
    5·2 answers
  • What is the role of epidermis in plants​
    11·2 answers
  • This class of medicines relieves coughing.
    9·1 answer
  • Cuales son los tipos de recursos naturales​
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • I WILL GIVE BRAINLIEST
    11·1 answer
  • Which statements describe geologic gaps? Check all that apply.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!