1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
10

3. Some plants grow better if bone meal (ground-up bones) is spread around their roots. What does

Biology
1 answer:
Mekhanik [1.2K]3 years ago
3 0

Answer:

B

Explanation:

bones are made from many minerals because of calcium;)

You might be interested in
When a piece of food contact equipment is in constant use it should be cleaned and sanitized every?
ad-work [718]
Food-service equipment should be carefully cleaned and sanitized, in order to prevent foodborne illnesses. Cleaning is the process of removing traces of food from surfaces while sanitizing is the process of removing microorganisms from surfaces. In general, food-contact equipment should be cleaned and sanitized after each use of the equipment. However, when the food-contact equipment is in constant use, it should be cleaned and sanitized every four hours.
5 0
3 years ago
Which one are more important Carbohydrates or Protein?
alex41 [277]

Answer:

Carbohydrate

Explanation:

6 0
3 years ago
I need help with biology Asap!!!!
jarptica [38.1K]

I think its C... but I'm not too sure. I did some research and couldn't find exactly what you were looking for but, I found loopholes and I think since when the cell increases, the surface area does not affect cell divisions steps. Therefore, I don't think it would change any other way...

5 0
4 years ago
What is the end of the muscle that connects to the bone that moves when the muscle contracts?
anzhelika [568]
So you have a muscle like the biceps brachii it’s origin is connected to the humerus then inserts to the radius origin didn’t move it’s static
7 0
3 years ago
The producers had 6,000 kcal of energy , how much would be passed to the primary consumer?
morpeh [17]

Answer:

600 kcal

Explanation:

In an ecosystem, energy is transferred from one organism in a trophic level to another organism in another trophic level. Organisms called PRODUCERS are capable of deriving energy from the sun. However, when fed upon by PRIMARY CONSUMERS, only about 10% of the energy is transferred to them because most of the energy (90%) is lost as heat.

Hence, in this case where the producers had 6,000 kcal of energy, 10% i.e. 10/100 of 6000 = 600 kcal of energy will be transferred to the primary consumers.

5 0
3 years ago
Other questions:
  • What is genetic modified food
    7·2 answers
  • Secondary structures are stabilized by which type of interaction?
    8·1 answer
  • How does the circulatory system interact with the digestive system
    13·2 answers
  • A researcher is studying the external plates of marine dinoflagellates to improve the taxonomy of these members of the phytoplan
    13·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is the general relationship between global earthquake activity and plate boundaries?
    13·1 answer
  • Do venus fly traps have to be in direct sun light or shade
    12·2 answers
  • Match the type of evidence for evolution with the correct example
    7·1 answer
  • Which are examples of genetic engineering? Check all that apply.
    12·2 answers
  • During ____, atoms arrange in a pattern over an over.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!