1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
11

Need help ASAP! Will give brainliest to right answer

Biology
1 answer:
larisa86 [58]3 years ago
4 0

Answer:

g2

Explanation:

have a nice day!

You might be interested in
Which of the following correctly compares the changes that take place in an ecosystem during primary succession and secondary su
n200080 [17]

Answer: B). Primary succession takes place over a long period of time on a newly formed land, while secondary succession occurs quickly in areas that have disrupted by a natural disaster.

Explanation:

A succession is a gradual change that occur within the biotic community due to change in the non-living environmental factors with respect to time until the community establish stability.

A primary succession occurs over a land which was not previously occupied by any living species. The land can be primitive, environmental factors like soil, air and others are not supportive initially. Thus, it takes long time to establish a biotic community.

A secondary succession occurs over a region which was previously inhabitated by colonies of species but disturbed due to natural calamity or human induced disaster. Some of the precursors of life can be found in such region like seeds, spores, roots and others which support new growth and the environmental factors are suitable to support re-establishment of living species. Hence, secondary succession takes place quickly as compared to primary succession.

3 0
3 years ago
Read 2 more answers
Which of the following terms is the accumulation of persistent toxins in our body? carcinogen body burden a biotic factor persis
zubka84 [21]
I think the correct answer from the choices listed above is the second option. The term that would refer to the accumulation of persistent toxins in our body would be body burden. It <span>can be the result of long-term or short-term storage of toxins. Hope this answers the question.</span>
8 0
4 years ago
Is there a difference between temperate forests and Temperate rainforest?
Leya [2.2K]
The main difference between temperate forests and tropical rainforests is their location. The location in turn contributes to climate, type of foliage and the way it looks. <span>Temperate forests are in both the northern and southern hemispheres between the tropics and the polar regions. Temperate rainforests are usually close to continental coasts.</span>
7 0
4 years ago
Whats the function of Organelle for
tankabanditka [31]
Dump and recycle center
6 0
3 years ago
The chemical energy stored in ATP during photosynthesis is released during the dark phase to _____.
Margaret [11]

answer-

produce carbohydrate from co2

5 0
3 years ago
Other questions:
  • What are the properties of a single-exposure, common-vehicle foodborne outbreak?
    11·1 answer
  • While the earth is home to many members of this phylum earthworms are not a member of blank
    12·2 answers
  • Epiphytic and parasitic plants grow on which of the following? Humans or rocks or dogs or plants
    14·1 answer
  • Protists that decompose dead organisms like insects are called. A. dinoflagellates. B. euglenoids. C. plasmodial slime molds. D.
    6·1 answer
  • Is there a resevior that serve only to takein carbon dioxide?<br>explain in your own word​
    7·1 answer
  • These are two different species in a habitat. Species A has fewer genetic variations. Species B has a considerable amount of gen
    12·1 answer
  • What is the best reas in that fire is NOT considered a living organism
    14·1 answer
  • What is the correct answer I accidentally clicked echo
    14·1 answer
  • During the Jurassic, what tectonic process was ongoing along the west coast of
    10·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!