1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
3 years ago
13

Help please ill give you a crown!

Biology
2 answers:
Sunny_sXe [5.5K]3 years ago
5 0

Answer:

Proteins

Explanation:

Yes, ofc this one is a easy one (for me).

daser333 [38]3 years ago
4 0

Answer:

Proteins

Explanation:

You might be interested in
Is the movement of water along the concentration gradient
Nuetrik [128]

Answer:

<em>- Is the movement of water along the concentration gradient: </em><em>Osmosis</em><em>. </em>

<em>- Is the use of energy to move the particles against the concentration gradient: </em><em>Active transport</em><em>. </em>

<em>- Is the movement of particles by diffusion without energy: </em><em>Simple diffusion</em><em>. </em>

<em>- Is the movement of particles along the concentration gradient: </em><em>Passive transport</em><em>.</em>

Explanation:

The mechanisms of cellular transport involve all the processes that the cell carries out to incorporate substances into its interior or send them to the extracellular space, through its semipermeable cell membrane.

<h3>- Osmosis</h3>

Is a type of transport that consists of the passage of water from a space with a lower concentration of solutes to one with a higher concentration, in order to reach equilibrium, following a concentration gradient.

The concentration gradient is given by the difference in concentration between two substances, which indicates the direction in which molecules, such as water, should move from one place to another.

<h3>- Active transport</h3>

Unlike passive transport mechanisms, which depend on a concentration gradient that determines the movement of particles, in active transport there are two characteristics that define it:

The passage of substances into the cell against a concentration gradient.

The use of energy to carry out this process.

In this case, the passage of substances through the cell membrane will be according to the requirements of the cell, or when they cannot pass through the membrane.

<h3>- Simple diffusion</h3>

According to the characteristics of the cell membrane, some substances can pass freely through it while others require special mechanisms. When a molecule is able to pass through the membrane without the use of special mechanisms or energy we speak of simple diffusion.

In a cell membrane, whose composition is by hydrophobic or non-polar lipid molecules, simple diffusion allows the passage of non-polar molecules, gases and alcohol.

<h3>- Passive transport</h3>

Refers to the mechanism of entry and exit of substances from the cell that does not require the use of energy.

The mechanisms involved in the passive transport of the cell are simple diffusion, osmosis, facilitated diffusion - which requires special conveyors or channels - and ultrafiltration, which depends on hydrostatic pressure. Examples of substances using this mechanism are lipid molecules, water and electrolytes.

Learn more:

Lipidic bilayer and cellular transport brainly.com/question/6955159

3 0
3 years ago
What compounds are raw materials used in cellular respiration
telo118 [61]

A.T.P, Carbon Dioxide.

8 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
HELP ME OUT PLS!!!!!!!!!!!!!!!!
zalisa [80]

Answer:

4.) ...many earthquakes are known to occur
5.) ... this type of boundary is called a transform plate boundary

Step by step:
i just learned this like a month ago

6 0
2 years ago
Plant photosynthesis and the consumption of plants by animals is best explained by what unifying principle of life? A) All livin
seropon [69]

Answer:

The correct answer is option A) "All living organisms use energy".

Explanation:

Even though living being use different strategies to obtain energy, an unifying principle among them is that all living organisms use energy to live. Plant use photosynthesis, which allows them to use sunlight, carbon dioxide and water to obtain energy. This classifies plant as producers, whereas animals that consume plants are primary consumers, animals that consume the animals that consume plants are second consumers, and so on.

5 0
3 years ago
Other questions:
  • A prenatal client with vaginal bleeding is admitted to the labor unit. which signs or symptoms indicate placenta previa? select
    13·1 answer
  • Which image is an example of a rod-shaped colony of bacteria?<br>lam​
    5·2 answers
  • Are Extreme Weather Events Increasing? Are heat waves and other extreme weather events increasing? When we turn on the news, we
    6·1 answer
  • Could the mother or the father (or both be "responsible" for this aneuploid condition in a child? explain your choice
    7·1 answer
  • How can the "shape" of a protein affect its function?
    10·2 answers
  • What is the dark crumbly high organic part of soil?
    5·1 answer
  • Multiple Allele So far we have studied traits or genes that are coded for by just two alleles. Like in rabbits, there was one al
    12·1 answer
  • Un organismo que solo come plantas es un (a)
    11·2 answers
  • Black panthers eat other animals in their ecosystem, including deer, fish,
    9·2 answers
  • What makes plants wilt?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!