1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
max2010maxim [7]
3 years ago
11

DNA and Biochemistry examples​

Biology
1 answer:
madam [21]3 years ago
5 0
I agree with the person on top have a good day:)
You might be interested in
What kinds of diseases can vaccinations prevent?
amm1812

Any infectious diseases can be prevented by vaccinations

<u>Explanation:</u>

  • Vaccines defend against infectious diseases that cause severe illness and seldom death.
  • It prevents disease in somebody who receives them and protects those who get into contact with unvaccinated individuals.
  • Vaccines include the corresponding antigens or parts of it that cause illnesses, but the antigens in vaccines are either destroyed or incapacitated.
  • When they are introduced into fatty tissue or muscle, vaccine antigens are not powerful enough to generate the symptoms and signs of the disease but are tough enough for the immune system to build antibodies against them.
3 0
3 years ago
Which planet in our solar system is known to support life
Aloiza [94]

Answer:

Explanation:

Earth, the third planet from the Sun, our home in the Solar System is the only planet or moon that is known to have the ability support support life. Earth has the right ingredients and is sufficiently far enough from the Sun to have just the right temperature to support life.

3 0
4 years ago
Read 2 more answers
PLZ HELP<br> What is the difference between weather and climate?
sergeinik [125]

Answer:

Weather is the short-term conditions the area is in, and climate is the long term, every-day weather, usually specific to an area based on its location.

Explanation:

7 0
3 years ago
Which of the
mojhsa [17]
The answer to this question is C. It is the largest volcano in the solar system.
3 0
4 years ago
Read 2 more answers
What are Macromolecules?
emmainna [20.7K]
That answer is correct
7 0
3 years ago
Other questions:
  • How does environmental change affect the survival of a species?<br> Please answer like a 6th grader!
    10·2 answers
  • The dental formula for fetal pig is? and explain what does mean?
    11·2 answers
  • which of the following is not part of the inflammatory response? A. white blood cells rush to infected tissues B. blood vessels
    10·1 answer
  • What is generation time for bacteria?​
    12·1 answer
  • Question 1
    6·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • According to the following diagram, approximately how much time goes y between phase H and phase B? Explain your answer.
    7·1 answer
  • on a nocturnal owl's skull, one ear points up and the other points down. suggest a hypothesis for this observation
    5·1 answer
  • Animals release energy needed for growth and repair through a
    11·1 answer
  • Explain how waves move the water if you drop a pebble into water
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!