Answer:
The correct answer will be option- C.
Explanation:
The bacteria can transfer its genetic material through three processes: transformation, conjugation and transduction. The process of conjugation takes place through the formation of the conjugating tube formed of the pili, the membrane extensions of the bacteria.
These pili are known as fertility pili or F-pili as they transfer the F-plasmid or fertility plasmid from the F⁺ bacteria containing the F-plasmid to the F⁻ cells or the bacterial cells which lack the F-plasmid.
Thus, option- C is the correct answer.
Answer:
A. dihybrid crosses
Explanation:
A dihybrid cross can be defined as a mating experiment between two lines/varieties/organisms that differ in two phenotypic traits. By using pea plants, Mendel performed dihybrid crosses in order to analyze the mode of inheritance of both phenotypic traits at the same time. From these mating experiments, Mendel observed that the inheritance factors (nowadays called genes) sorted independently from one another in the next generation, which is called the principle/law of Independent Assortment.
The answer is either C because both C and D cause disease, but only C is a living organism. Hope that helps!
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
