1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
9

In relation to a food chain, what do plants and photosynthetic algae have in common?

Biology
1 answer:
svet-max [94.6K]3 years ago
5 0

Explanation:

They are both producers. ... Their numbers are limited by the energy they take in from heterotrophic food sources.

You might be interested in
Jika satuan kecepatan adalah m/s maka dimensinya adalah ​
bogdanovich [222]
What language is this ?.
3 0
3 years ago
Skin cells reproduce rapidly to heal a cut or scrape. How do mitochondria help the
rusak2 [61]

Answer:

by making energy available for the cells to use

7 0
3 years ago
TRUE/FALSE. establishing a family history of osteoarthritis, rheumatoid arthritis, or ankylosing spondylitis is important becaus
Vlad [161]

TRUE if the genetic component of a family history of osteoarthritis, rheumatoid arthritis, or ankylosing spondylitis is significant.

<h3>What are rheumatoid arthritis, ankylosing spondylitis, and osteoarthritis?</h3>

Ankylosing spondylitis (AS) and rheumatoid arthritis (RA) are two of the most prevalent rheumatic illnesses. The joint degradation and decline in physical fitness are caused by these chronic progressive inflammatory disorders. [1] Their symptomatology and etiology differ despite being closely related.

<h3>What aspects of a patient's condition might point to a higher risk of osteoarthritis?</h3>

Age: As people get older, their chance of having OA rises. Gender—After the age of 50, women are more likely than males to acquire OA. Obesity—Extra weight increases the strain on joints, especially those that bear the body's weight, including the hips and knees.

To know more about osteoarthritis visit:-

brainly.com/question/29569397

#SPJ4

3 0
2 years ago
Respiration is a process where many chemical bonds inside the body break and release energy. This energy is used to perform vari
fgiga [73]

Answer:

organism obtain energy by combining oxygen and glucose, resulting in the release of carbon dioxide, water, and ATP.  

Explanation:

4 0
3 years ago
What will be the genotype ratio if you cross two plants with the genotype RR and rr
Sergio039 [100]

Answer:

The genotype ratio will be one.

Explanation:

allele RR produces two same type of gamete, that is R. And allele rr also produces two same type of gamete r.

When we prepare checker board then we found that only one type of genotype will formed. That is Rr(heterozygote).

8 0
4 years ago
Other questions:
  • A group of environmental scientists wants to study the impact of population growth on the environment. Which discipline will con
    15·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • __________ are a group of genetically identical individuals produced by a process called __________.
    9·1 answer
  • The big bang theory states that the universe began with a gigantic explosion ?
    9·1 answer
  • I need help, need correct answer
    11·1 answer
  • How do you measure the area of the peepal leaf?Explain​
    11·2 answers
  • The combination of absolute and relative dating allows scientists to determine the ages of rocks and fossils. Absolute dating pr
    10·1 answer
  • HELP YALL I NEED IT RN
    6·1 answer
  • The part of the brain that consolidates smell into the hippocampus from the olfactory bulbs is the?
    12·1 answer
  • Help me plss, I will brainliest
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!