1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
k0ka [10]
2 years ago
12

Which part of the graph represents how much energy the reactants need

Biology
1 answer:
abruzzese [7]2 years ago
5 0

Answer: The answer is F

Explanation: I just did it on A P E X

You might be interested in
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Define diffusion and osmosis
poizon [28]
Diffusion is the movement of substances from high to low concentration

osmosis is the diffusion of water through a semipermeable membrane from high to low water concentration
7 0
3 years ago
Read 2 more answers
What substances have the same number of carbon atoms
Shalnov [3]

Answer: Hydrocarbons

Explanation:

hope this helps! -thelonelyastronaut

6 0
3 years ago
How do you change the objective lenses?
Marta_Voda [28]

Answer:

<em>When focusing on a slide, ALWAYS start with either the 4X or 10X objective. Once you have the object in focus, then switch to the next higher power objective. Re-focus on the image and then switch to the next highest power.</em>

4 0
2 years ago
Read 2 more answers
When an organism is changed ir altered from its parent or original form​
labwork [276]

Answer:

GMO, Hope this helped..... Please give me brainliest it would make my day 100 percent better

Explanation:

GMOs are organisms that have had their characteristics changed through the modification of their DNA. GMO stands for genetically modified organism.

4 0
2 years ago
Other questions:
  • Veins have a much lower blood pressure than arteries. Which of these prevents backflow of blood in veins? A. pressure applied by
    9·2 answers
  • Which is a goal of the Human Genome Project
    15·2 answers
  • What are the three types of cell signaling
    11·1 answer
  • What is the different between partially permeable membrane and permeable membrane
    13·1 answer
  • What is delta and how is it used
    9·2 answers
  • Which two examples show adaptations for plants growing in the desert?
    13·1 answer
  • There’s less water available for human consumption. Which biome is affected the most by this change?
    8·1 answer
  • HELP ASAP WITH THIS GIVING BRAINLIST
    9·1 answer
  • Making vegetable portions on your dinner plate twice the size of your meat portion would be a great strategy to
    5·1 answer
  • When describing a community, a biologist would identify every
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!