1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
13

SUPER Challenge: What is a “really easy” way to lose weight without losing mass? Actually for science

Biology
1 answer:
ExtremeBDS [4]3 years ago
6 0
You could go to like the moon because you never lose mass you mass always stays the same but your weight changes depending on how hard gravity is pushing you down
You might be interested in
If the supply of carbon dioxide stops in plant, what will happen to the process of
V125BC [204]

Answer:

All plants and animals on earth engage in a process called respiration. Respiration combines oxygen and the food created during photosynthesis to produce usable energy. One of the byproducts of respiration is CO2, this is the opposite of photosynthesis. It is not unusual for plants to stop taking in carbon dioxide to uptake small amounts of oxygen at night.

In the event that plants cease to take up CO2 all together, they will cease to convert sunlight into carbohydrates, and die. The death of autotrophs would lead to a chain reaction of the death of all higher order organisms. Mankind could survive on food stuffs on hand, but only for a very short time. It has been said that any western society, its members are just 3 meals away from revolution.

Social order would be completely lost during the initial food riots. Once the processed and packaged food supply is exhausted, it would be the law of the dying jungle. The strong and well armed would take from the weak and ill prepared. Livestock and game would be slaughtered as the next to the last food source disappeared. The shear volume of death would foul the water spreading pestilence and disease. In one or two years bands of humans would prey on other humans as they degenerate into cannibalism. There could be a few humans in protected bunkers and hideaways, but they too would eventually succumb to starvation or despair as the world died.

The fact that plants stopped converting CO2 into O2 would be of little consequence. Man would die of hunger 1000 years before oxygen was ever an issue.

3 0
2 years ago
No Light<br> Yo =<br> Gas<br> Gas<br> Water<br> Plant
sergiy2304 [10]

Answer: No light = emanate unescapable death if that is your question

Explanation: If starvation doesn't kill you some other person trying to survive will now if you will excuse me I am going to go tell someone else the harsh reality we all live in

5 0
3 years ago
Describe three types of barriers that can cause populations to become reproductively isolated from each other.
Stells [14]
Name the three types of barriers that can isolate populations.<span>
Answer: Behavioral isolation, geographic isolation, and temporal isolation</span>
7 0
4 years ago
Explain how privatizing endangered species (private ownership) will save them from extinction. Give an example. (approximately 5
-BARSIC- [3]

Answer: The privatization of endangered species will reduce their chances of extinction.

Explanation:

The endangered species are those species which are low in numbers, their population will reduce or extinct in the near future. The privatization of these animals will protect them from dangers of trafficking, predation, habitat loss, and death due to natural disaster. Animals like elephant, monkey, tiger, lion are privatized to protect their extinction.

The trade of hides, teeth, ivory, flesh, horn, and other parts of the endangered animals will accelerate the rate of extinction. Prohibition of trade will allow the agents of trafficking to get chances of killing and stealing animal parts to a large number.

The tragedy of commons suggests that people neglect the well being of the society for personal gain. Those people who exploit the resources from endangered species causing harm to the nature as they are responsible for reducing biodiversity.

6 0
3 years ago
Clues to what ancient climates were like come from all of the following except
Free_Kalibri [48]
Clues to ancient climates came from all of the above except plant pollen. This is bcause plant pollen either became dirt or became plants.
8 0
3 years ago
Other questions:
  • __________ is the illegal use of another author's material without permission or citation. A. Quoting B. Custodial loss C. Sland
    14·2 answers
  • Which of these statements describes one possible interaction between the endocrine and respiratory systems?
    7·1 answer
  • In order to understand the impact of climate change, a scientist collected measurements of average yearly sea surface temperatur
    6·1 answer
  • After several miles of running and sprinting in intervals, the runner’s muscles ache and feel fatigued. Which is the best explan
    12·2 answers
  • Differences in which property allow the separation of a sample of sand and seawater by filtration
    9·1 answer
  • Chapter 14 study guide biology
    8·1 answer
  • Please provide a legitimate answer and provide an explanation for the question below.
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Factoring web analysis​
    15·1 answer
  • What happens when you have low enzyme production?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!