1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verdich [7]
3 years ago
7

In some deserts, the air temperature can change over 60 to 70 degrees in a single day. Which of these properties

Biology
1 answer:
bazaltina [42]3 years ago
3 0

Answer:

Being endothermic

Explanation:

Humans are not cold-blooded and we don't photosynthesise so only the second option applies to humans;

We produce heat internally within our bodies so we are endotherms, i.e. warm-blooded;

We shiver and have thermogenesis through metabolism to generate heat to keep body temp up and also sweating and physiological mechanisms to cool out bodies down.

You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Compared the endocrine system, the nervous system is __________.
velikii [3]
The nervous system can respond quickly to stimuli, through the use of action potentials and neurotransmitters. Responses to nervous system stimulation are typically quick but short lived. The endocrine system responds to stimulation by secreting hormones into the circulatory system that travel to the target tissue.
4 0
3 years ago
Pioneered early research demonstrating that an association between a neutral stimulus and an automatic behavior could be learned
Sauron [17]

Answer:

Ivan Pavlon is regarded as the father of classical conditioning using dog salivation experiment in its study.

Explanation:

The research study was carried out by Ivan Petrovich Pavlov, a Russian physiologist widely recognized mainly for his work in classical conditioning. During his juvenile days, Pavlov developed intellectual thoughtfulness along with an uncommon desire which he himself said was "the instinct for research" in his own words.

4 0
4 years ago
A particular membrane transport process exhibits saturation, uses carrier molecules, but does NOT require ATP. The process is pr
Musya8 [376]

Answer:

Faciliated diffusion, which requires a carrier protein but no cellular energy. The energy for this process is provided by the concentration gradient of the substance being transported.

7 0
3 years ago
Which portion of the ear is responsible for sound transduction?
TEA [102]
The cochlea is responsible for sound transduction.
8 0
3 years ago
Other questions:
  • The plants that form the basis of rain forests are _____.
    6·2 answers
  • In amino acid composition analysis, amino acids are visualized after separation using the chemical reagent _______________.
    10·1 answer
  • What part of the sweating process promotes cooling?
    11·2 answers
  • What property of a magnifying lens is most responsible for allowing it to magnify a penny?A. It can reflect light.B. It can refr
    10·2 answers
  • Write out the acronym<br>for DRY MIX below:<br><br><br><br>I NEED HELP​
    6·1 answer
  • When Alfred Wegener first noticed that the continents fit together like puzzle pieces, this was
    6·1 answer
  • Elect all answer choices that are physical properties (more than 1)
    5·1 answer
  • DNA replication occurs during<br> a) S phase<br> b) Mitosis<br> c) G1 phase<br> d) Prophase
    10·1 answer
  • Hooke made scientific advancements that revolutionized our understanding of the basic building blocks of life.
    14·1 answer
  • Explain:<br> - Adult Cell Cloning<br> - Embryo Transplants<br> - Somatic Cell Nuclear Transfer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!