1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrac [35]
3 years ago
10

What information cannot be studied effectively using human torso models? I. the approximate sizes of organs II. the textures of

organs III. the interrelationships of organ functions IV. the positions of organs within the body
Biology
1 answer:
V125BC [204]3 years ago
4 0

Answer:

II. the textures of organs

Explanation:

A human torso model is designed to be as accurate as possible so that students/researchers can understand the inner workings of the body. Therefore, the organs have been designed to be the same size of an actual human being of that stature, while also being in the correct position within the body to better understand the interrelationships between the organs. The only thing that is not accurate in these models is the texture of the organs as most are smooth plastic unlike the actual organs.

You might be interested in
1. How is DNA replicated?
7nadin3 [17]
The initiation of DNA replication<span> occurs in two steps. First, a so-called initiator protein unwinds a short stretch of the </span>DNA<span> double helix. Then, a protein known as helicase attaches to and breaks apart the hydrogen bonds between the bases on the </span>DNA<span> strands, thereby pulling apart the two strands.</span>
8 0
3 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
​​​which food item is likely to be most acceptable to a child?
QveST [7]
Rubber or plastic cutlery are most likely to be most acceptable for a child, spoons are less dangerous and come in different colors and shapes so childs can get familiar with them and start the learning eating process by themselves, then they are presented with the fork, which also comes in different shapes and colors, this will complement the training for the infant.
6 0
4 years ago
98 POINTS
dybincka [34]
9=a 10=b 11=f 12=c 13=d 14=e
6 0
3 years ago
Read 2 more answers
What is the "Cell (plasma) membrane"? Question 1 options:
Svet_ta [14]

Answer:

<em>The</em><em> </em><em>fi</em><em>rst</em><em> </em><em>option</em>

Explanation:

<em>The</em><em> </em><em>cell</em><em> </em><em>membrane</em><em> </em><em>is</em><em> </em><em>the</em><em> </em><em>st</em><em>r</em><em>u</em><em>c</em><em>t</em><em>u</em><em>r</em><em>e</em><em> </em><em>that</em><em> </em><em>forms</em><em> </em><em>the</em><em> </em><em>surf</em><em>ace</em><em> </em><em>of</em><em> </em><em>a</em><em> </em><em>cell</em><em> </em><em>separating</em><em> </em><em>it's </em><em>contents</em><em> </em><em>from</em><em> </em><em>the</em><em> </em><em>out</em><em>side</em><em> </em><em>world</em><em>.</em>

8 0
3 years ago
Read 2 more answers
Other questions:
  • If you are in an emergency and there is no space to the side to steer out of the way of a crash, __________.
    15·1 answer
  • Members of a given species _____.
    13·2 answers
  • Which main characteristics describe weather?
    8·1 answer
  • When fertilizer runs off into streams and lakes, what increases in the water? Select all that apply.
    12·2 answers
  • 6. Jayden recently learned that the atmosphere is made of gases. Which is NOT a way in which
    7·1 answer
  • Some insect species are resistant to pesticides. Which statement BEST explains this phenomenon? Natural selection resulted in an
    8·1 answer
  • The aorta is a vein. True False
    9·2 answers
  • BRAINLIEST IF RIGHT 20+ POINTS
    5·2 answers
  • I need an example of natural solution! (ex: a giraffe with a long neck) and I need an explanation on how it has adapted to it’s
    14·1 answer
  • Why do kids. Have school
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!